Two-hybrid analysis of the interaction between the fission yeast proteins Sal3 and Cdc25

Cdc25 is a mitosis triggering phosphatase in Schizosaccharomyces pombe, and is transported in to the nucleus during G2 phase by the importin-β protein Sal3. Cdc25 triggers mitosis and cell division by dephosphorylating tyrosine 15 of Cdc2. In sal3 mutants, Cdc25 is not transported into the nucleus and the cells halt in G2. The purpose of this study is to use a two-hybrid system to determine the nature of the relationship between Sal3 and Cdc25. Previous research has failed to detect any interaction between the two proteins, but specific modifications were made to the two-hybrid system in this study including the separation of Sal3 into its two binding domains, the addition of fluorescent tags to the fusion protein, and the reversal of plasmids in the fusion proteins. Unique PCR primers were successfully designed, based on a multiple alignment of Sal3 and its homologues, to separate Sal3 into its two domains.

Analysis of Lipoprotein(a) Catabolism

Elevated plasma concentrations of lipoprotein(a) [Lp(a)] have been identified as an independent risk factor for vascular diseases including coronary heart disease and stroke. In the current study, we have examined the binding and degradation of recombinant forms of apolipoprotein(a) [r-apo(a)], the unique kringle-containing moiety of Lp(a), using a cultured cell model. We found that the incubation of human hepatoma (HepG2) cells with an iodinated 17 kringle-containing (17K) recombinant form of apo(a) resulted in a two-component binding system characterized by a high affinity (Kd = 12 nM), low capacity binding site, and a low affinity (Kd = 249 nM), high capacity binding site. We subsequently determined that the high affinity binding site on HepG2 cells corresponds to the LDL receptor. In the HepG2 cell model, association of apo(a) with the LDL receptor was shown to be dependent on the formation of Lp(a) particles from endogenous LDL. Using an apo(a) mutant incapable of binding to the high affinity site through its inability to form Lp(a) particles (17KΔLBS7,8), we further demonstrated that the LDL receptor does not participate in Lp(a) catabolism. The low affinity binding component observed on HepG2 cells, familial hypercholesterolemia (FH) fibroblasts and human embryonic kidney (HEK) 293 cells may correspond to a member(s) of the plasminogen receptor family, as binding to this site(s) was decreased by the addition of the lysine analogue epsilon-aminocaproic acid. The lysine-dependent nature of the low affinity binding site was further confirmed in HepG2 binding studies utilizing r-apo(a) species with impaired lysine binding ability. We observed a reduction maximum binding capacity for 17K r-apo(a) variants lacking the strong lysine binding site (LBS) in kringle IV type 10 (17KΔAsp) and the very weak LBS in kringle V (17KΔV). Degradation of Lp(a)/apo(a) was found to be mediated exclusively by the low affinity component on both HepG2 cells and FH fibroblasts. Fluorescence confocal microscopy, using the 17K r-apo(a) variant fused to green fluorescent protein, further confirmed that degradation by the low affinity component on HepG2 cells does not proceed by the activity of cellular lysosomes. Taken together, these data suggest a potentially significant route for Lp(a)/apo(a) clearance in vivo.

Solid-phase synthesis of terminal oligonucleotide-phosphoramidate conjugates

A novel phosphoramidite, N,N-diisopropylamino-2-cyanoethyl-9-anthracenemethyl phosphoramidite 1, was prepared and coupled with the terminal 5'-hydroxyl of support-bound T10 and the putative phosphite triester intermediate was subsequently reacted with iodine in the presence of either water or a series of primary and secondary amines. The reactivity of 1 compared to a previously reported benzyl phosphoramidite 2 was also investigated: oxidation of the product of coupling 2 with CPG-T10-5'OH under aqueous conditions resulted in greater than 30% of the benzyl moiety being retained. In contrast, essentially complete loss of the 9-anthracenemethyl group was observed using 1 under the same conditions. Oligonucleotides modified with a terminal phosphate monoester, lipophilic, fluorescent or cationic groups were thus prepared.

Amyloid B-peptide 1-40 increases neuronal membrane fluidity: role of cholesterol and brain region

There is increasing evidence of an interaction between cholesterol dynamics and Alzheimer's disease (AD), and amyloid ß-peptide may play an important role in this interaction. Aß destabilizes brain membranes and this action of Aß may be dependent on the amount of membrane cholesterol. We tested this hypothesis by examining effects of Aß1-40 on the annular fluidity (i.e., lipid environment adjacent to proteins) and bulk fluidity of rat synaptic plasma membranes (SPM) of the cerebral cortex, cerebellum, and hippocampus using the fluorescent probe pyrene and energy transfer. Amounts of cholesterol and phospholipid of SPM from each brain region were determined. SPM of the cerebellum were significantly more fluid as compared with SPM of the cerebral cortex and hippocampus. Aß significantly increased (P 0.01) annular and bulk fluidity in SPM of cerebral cortex and hippocampus. In contrast, Aß had no effect on annular fluidity and bulk fluidity of SPM of cerebellum. The amounts of cholesterol in SPM of cerebral cortex and hippocampus were significantly higher (P 0.05) than amount of cholesterol in SPM of cerebellum. There was significantly less (P 0.05) total phospholipid in cerebellar SPM as compared with SPM of cerebral cortex. Neuronal membranes enriched in cholesterol may promote accumulation of Aß by hydrophobic interaction, and such an interpretation is consistent with recent studies showing that soluble Aß can act as a seed for fibrillogenesis in the presence of cholesterol.

Rational Attenuation of a Morbillivirus by Modulating the Activity of the RNA-Dependent RNA Polymerase

Negative-strand RNA viruses encode a single RNA-dependent RNA polymerase (RdRp) which transcribes and replicates the genome. The open reading frame encoding the RdRp from a virulent wild-type strain of rinderpest virus (RPV) was inserted into an expression plasmid. Sequences encoding enhanced green fluorescent protein (EGFP) were inserted into a variable hinge of the RdRp. The resulting polymerase was autofluorescent, and its activity in the replication/transcription of a synthetic minigenome was reduced. We investigated the potential of using this approach to rationally attenuate a virus by inserting the DNA sequences encoding the modified RdRp into a full-length anti-genome plasmid from which a virulent virus (rRPV(KO)) can be rescued. A recombinant virus, rRPV(KO)L-RRegfpR, which grew at an indistinguishable rate and to an identical titer as rRPV(KO) in vitro, was rescued. Fluorescently tagged polymerase was visible in large cytoplasmic inclusions and beneath the cell membrane. Subcutaneous injection of 10(4) TCID(50) of the rRPV(KO) parental recombinant virus into cattle leads to severe disease symptoms (leukopenia/diarrhea and pyrexia) and death by 9 days postinfection. Animals infected with rRPV(KO)L-RRegfpR exhibited transient leukopenia and mild pyrexia, and the only noticeable clinical signs were moderate reddening of one eye and a slight ocular-nasal discharge. Viruses that expressed the modified polymerase were isolated from peripheral blood lymphocytes and eye swabs. This demonstrates that a virulent morbillivirus can be attenuated in a single step solely by modulating RdRp activity and that there is not necessarily a correlation between virus growth in vitro and in vivo.

Measles virus superinfection immunity and receptor redistribution in persistently infected NT2 cells

A recombinant measles virus (MV) expressing red fluorescent protein (MVDsRed1) was used to produce a persistently infected cell line (piNT2-MVDsRed1) from human neural precursor (NT2) cells. A similar cell line (piNT2-MVeGFP) was generated using a virus that expresses enhanced green fluorescent protein. Intracytoplasmic inclusions containing the viral nucleocapsid protein were evident in all cells and viral glycoproteins were present at the cell surface. Nevertheless, the cells did not release infectious virus nor did they fuse to generate syncytia. Uninfected NT2 cells express the MV receptor CD46 uniformly over their surface, whereas CD46 was present in cell surface aggregates in the piNT2 cells. There was no decrease in the overall amount of CD46 in piNT2 compared to NT2 cells. Cell-to-cell fusion was observed when piNT2 cells were overlaid onto confluent monolayers of MV receptor-positive cells, indicating that the viral glycoproteins were correctly folded and processed. Infectious virus was released from the underlying cells, indicating that persistence was not due to gross mutations in the virus genome. Persistently infected cells were superinfected with MV or canine distemper virus and cytopathic effects were not observed. However, mumps virus could readily infect the cells, indicating that superinfection immunity is not caused by general soluble antiviral factors. As MVeGFP and MVDsRed1 are antigenically indistinguishable but phenotypically distinct it was possible to use them to measure the degree of superinfection immunity in the absence of any cytopathic effect. Only small numbers of non-fusing green fluorescent piNT2-MVDsRed1 cells (1 : 300 000) were identified in which superinfecting MVeGFP entered, replicated and expressed its genes.

Dynamics and Function of Langerhans Cells In Vivo: Dermal Dendritic Cells Colonize Lymph Node Areas Distinct from Slower Migrating Langerhans Cells

Langerhans cells (LCs) are prominent dendritic cells (DCs) in epithelia, but their role in immunity is poorly defined. To track and discriminate LCs from dermal DCs in vivo, we developed knockin mice expressing enhanced green fluorescent protein (EGFP) under the control of the langerin (CD207) gene. By using vital imaging, we showed that most EGFP(+) LCs were sessile under steady-state conditions, whereas skin inflammation induced LC motility and emigration to lymph nodes (LNs). After skin immunization, dermal DCs arrived in LNs first and colonized areas distinct from slower migrating LCs. LCs reaching LNs under steady-state or inflammatory conditions expressed similar levels of costimulatory molecules. Langerin and EGFP were also expressed on thymic DCs and on blood-derived, CD8alpha(+) DCs from all secondary lymphoid organs. By using a similar knockin strategy involving a diphtheria toxin receptor (DTR) fused to EGFP, we demonstrated that LCs were dispensable for triggering hapten-specific T cell effectors through skin immunization.

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

Functional comparison of the endothelial nitric oxide synthase Glu298Asp polymorphic variants in human endothelial cells

The G894T endothelial nitric oxide synthase (eNOS) polymorphism results in a Glu to Asp substitution at position 298. This position is located externally on the protein and as the regulation of eNOS is dependent on its subcellular localization and interaction with modulatory proteins, we aimed to address whether the substitution of Asp at 298 had any effect on these mechanisms. Initially, we developed a novel method to accurately determine molar quantities of each variant by expressing them as green fluorescent protein (GFP) fusion proteins and using recombinant adenoviruses to facilitate transient infection of human microvascular endothelial cells. Sodium dodecyl sulphate-polyacrylamide gel electrophoresis and Western blotting of eNOS298Asp revealed a 135-kDa proteolytic fragment which was not present with eNOS298Glu. This proteolysis was prevented by using LDS buffer confirming that this differential cleavage is an artefact of sample preparation and unlikely to occur intracellularly. Nitric oxide was measured following stimulation with calcium ionophore or oestrogen in the presence of varying sepiapterin concentrations. GFP fluorescence was used to quantify the amount of fusion protein and calculate intracellular specific activity. There was no significant difference in intracellular specific activity between Glu298 and Asp298 eNOS in response to calcium ionophore or oestrogen. Tetrahydrobiopterin supplementation increased eNOS activity of both variants in an identical manner. The presence of the GFP also facilitated the visualization of the variants by confocal microscopy and demonstrated that both localized to the plasma membrane and the Golgi. These findings demonstrate that the Asp substitution at 298 does not have a major effect in modulating eNOS activity in vivo.

A novel diagnostic test detects a low frequency of the hemicentin Gln5345Arg variant among Northern Irish age related macular degeneration patients.

Purpose: Age related macular degeneration (AMD) is a common cause of severe vision loss. Identification of genes involved in AMD will facilitate early detection and ultimately help to identify pathways for treatment for this disorder. The A16,263G mutation in the HEMICENTIN-1 gene produces a non-conservative substitution of arginine for glutamine at codon 5345 which has been implicated in familial AMD. The aim of this study is to develop a rapid diagnostic assay for the detection of this mutation and to evaluate its frequency in a sample of AMD patients. Methods: A primer probe set was designed from exon 104 of the HEMICENTIN-1 gene to differentiate between mutant and wild type alleles. A region spanning the mutation was amplified by PCR using a LightCycler (Roche Diagnostic). The mutation was then detected by melt curve analysis of the hybrid formed between the PCR product and a specific fluorescent probe. The frequency of the mutation within the Northern Ireland population was evaluated by assaying 508 affected AMD patients, 25 possibly affected and 163 controls. Results: This assay clearly discriminates between the A16,263G mutant and wild type HEMICENTIN-1 alleles. The wild type sequence has a single base mismatch with the probe which decreases the stability of the hybrid, resulting in a lower TM (TM=51.27 °C) than that observed for the perfectly matched mutant allele (TM=59.9 °C). The mutant allele was detected in only one of the 696 subjects, an affected AMD patient. Conclusions: We describe a rapid assay for the genotyping of the Gln5345Arg mutation using real-time fluorescence PCR to facilitate rapid processing of samples through combined amplification and detection steps. These characteristics are suitable for a clinical setting where high throughput diagnostic procedures are required. The frequency of this mutation within the Northern Ireland population has been estimated at 0.2%, concurring with previous findings that this mutation is a rare variant associated with AMD. A rapid diagnostic assay will facilitate a reliable and convenient evaluation of the frequency of the Gln5345Arg mutation and its association with AMD within other populations.

Morphology and localization of interstitial cells in the guinea pig bladder: structural relationships with smooth muscle and neurons.

PURPOSE: In the current study we examined the location of interstitial cell of Cajal (ICC)-like cells in the guinea pig bladder wall and studied their structural interactions with nerves and smooth muscle cells. MATERIALS AND METHODS: Whole mount samples and cryosections of bladder tissue were labeled with primary and fluorescent secondary antibodies, and imaged using confocal and multiphoton microscopy. RESULTS: Kit positive ICC-like cells were located below the urothelium, in the lamina propria region and throughout the detrusor. In the suburothelium they had a stellate morphology and appeared to network. They made connections with nerves, as shown by double labeling experiments with anti-kit and anti-protein gene product 9.5. A network of vimentin positive cells was also found, of which many but not all were kit positive. In the detrusor kit positive cells were most often seen at the edge of smooth muscle bundles. They were elongated with lateral branches, running in parallel with the bundles and closely associated with intramural nerves. Another population of kit positive cells was seen in the detrusor between muscle bundles. These cells had a more stellate-like morphology and made connections with each other. Kit positive cells were seen tracking nerve bundles and close to intramural ganglia. Vimentin positive cells were present in the detrusor, of which some were also kit positive. CONCLUSIONS: There are several populations of ICC-like cells throughout the guinea pig bladder wall. They differ in morphology and orientation but all make connections with intramural nerves and in the detrusor they are closely associated with smooth muscle cells.

Langerhans cells--revisiting the paradigm using genetically engineered mice.

Langerhans cells (LCs) are prominent dendritic cells (DCs) in epithelia, but their role in immunity and tolerance is poorly defined. 'Knockin' mice expressing enhanced green fluorescent protein (EGFP) under the control of the langerin (CD207) gene were recently developed in order to discriminate epidermal LCs from other DC subsets and at the same time to track their dynamics under steady-state or inflammatory conditions in vivo. Additional knockin mice expressing a diphtheria toxin receptor fused to EGFP were used to conditionally ablate LCs and assess their role in triggering hapten-specific T cell effectors through skin immunization. We review the insights that have been provided by these various knockin mice and discuss gaps in our knowledge of LCs that need to be filled.

Measles virus minigenomes encoding two autofluorescent proteins reveal cell-to-cell variation in reporter expression dependent on viral sequences between the transcription units.

Transcription from morbillivirus genomes commences at a single promoter in the 3' non-coding terminus, with the six genes being transcribed sequentially. The 3' and 5' untranslated regions (UTRs) of the genes (mRNA sense), together with the intergenic trinucleotide spacer, comprise the non-coding sequences (NCS) of the virus and contain the conserved gene end and gene start signals, respectively. Bicistronic minigenomes containing transcription units (TUs) encoding autofluorescent reporter proteins separated by measles virus (MV) NCS were used to give a direct estimation of gene expression in single, living cells by assessing the relative amounts of each fluorescent protein in each cell. Initially, five minigenomes containing each of the MV NCS were generated. Assays were developed to determine the amount of each fluorescent protein in cells at both cell population and single-cell levels. This revealed significant variations in gene expression between cells expressing the same NCS-containing minigenome. The minigenome containing the M/F NCS produced significantly lower amounts of fluorescent protein from the second TU (TU2), compared with the other minigenomes. A minigenome with a truncated F 5' UTR had increased expression from TU2. This UTR is 524 nt longer than the other MV 5' UTRs. Insertions into the 5' UTR of the enhanced green fluorescent protein gene in the minigenome containing the N/P NCS showed that specific sequences, rather than just the additional length of F 5' UTR, govern this decreased expression from TU2.

The role of a kinesin, KLP-20, on neural development and epidermal morphogenesis in Caenorhabditis elegans

The heterotrimeric kinesin-II motor in Caenorhabditis elegans consists of KLP-20, KLP-11, and KAP-1 subunits and broadly functions in cellular transport for the development of biological structures including cilia and axons. The results of this paper support the ubiquitous and necessary role kinesin-II motors have in development, particularly the KLP-20 microtubule-associating subunit. Mutations in klp-20 result in a variable abnormal (vab) phenotype characterized by observable epidermal defects, although the role of this gene in development and the mechanism by which the vab phenotype is produced is largely unknown. The vab phenotype is highly penetrant in the first larval stage (L1) of C. elegans, which supports that klp-20 functions in early development. Ciliated amphid sensory neurons can be stained with a fluorescent dye, DiI, to simultaneously test cilia structure and function, as well as the morphology of the amphid sensory organ. Reduced dye uptake in klp-20 mutant L1s suggests that the microtubule-based cilia are under-developed as a result of defective kinesin-II function. Consistent observations of the PLM mechanosensory neuron using the zdIs5 reporter suggest that klp-20 has an essential role in neuron development, as mutations to klp-20 result in under-developed PLM axons. Qualitative observations suggest there may be an interaction between the development of the overlying epidermis and the underlying nervous system, as a more severe vab phenotype is observed simultaneously with reduced dye uptake, and hence amphid sensory cilia under-development. Furthermore, a more severe vab phenotype manifested as large bumps on the posterior epidermis appears to be spatially correlated with PLM defects. The results presented and discussed in this paper suggest that KLP-20 has a necessary role in neurodevelopment and epidermal morphogenesis in C. elegans during embryogenesis.

The tissue plasminogen activator gene promoter: a novel tool for radiogenic gene therapy of the prostate?

Radiation therapy is a treatment modality routinely used in cancer management so it is not unexpected that radiation-inducible promoters have emerged as an attractive tool for controlled gene therapy. The human tissue plasminogen activator gene promoter (t-PA) has been proposed as a candidate for radiogenic gene therapy, but has not been exploited to date. The purpose of this study was to evaluate the potential of this promoter to drive the expression of a reporter gene, the green fluorescent protein (GFP), in response to radiation exposure. METHODS: To investigate whether the promoter could be used for prostate cancer gene therapy, we initially transfected normal and malignant prostate cells. We then transfected HMEC-1 endothelial cells and ex vivo rat tail artery and monitored GFP levels using Western blotting following the delivery of single doses of ionizing radiation (2, 4, 6 Gy) to test whether the promoter could be used for vascular targeted gene therapy. RESULTS: The t-PA promoter induced GFP expression up to 6-fold in all cell types tested in response to radiation doses within the clinical range. CONCLUSIONS: These results suggest that the t-PA promoter may be incorporated into gene therapy strategies driving therapeutic transgenes in conjunction with radiation therapy.