Degradação luminosa e retenção foliar dos corantes azul brilhante FDC-1 e amarelo tartrasina FDC-5 utilizados como traçadores em pulverizações

Três estudos foram conduzidos no Núcleo de Pesquisas Avançadas em Matologia (NUPAM) pertencente à UNESP/FCA - campus de Botucatu-SP, com o objetivo de avaliar a estabilidade dos corantes Azul Brilhante FDC-1 e Amarelo Tartrasina FDC-5 quanto a diferentes períodos de exposição à luz solar e contato com folhas de Eichhornia crassipes. No primeiro estudo, soluções de 0,3125, 0,625, 1,25, 2,5, 5, 10 e 20 ppm dos corantes Azul Brilhante FDC-1 e Amarelo Tartrasina FDC-5 foram acondicionadas em tubos de quartzo hermeticamente fechados e submetidos a 0, 0,5, 1, 2, 4, 6 e 10 horas de exposição à luz solar e ao escuro. Ao final de cada período, amostras de 10 mL foram retiradas dos tubos e analisadas. No segundo estudo, os tratamentos foram dispostos no esquema fatorial 2x7: duas condições luminosas (escuro e pleno sol) e sete períodos de exposição (0, 0,5, 1, 2, 4, 6 e 10 horas), com seis repetições. Com o auxílio de micropipeta, oito gotas de 5 µL das soluções Azul Brilhante e Amarelo Tartrasina a 4.000 ppm foram depositadas em placas de Petri de vidro. Após o término dos períodos de exposição, as placas foram lavadas com 50 mL de água destilada, com o objetivo de extrair o corante depositado sobre elas. No terceiro estudo, adotaram-se os mesmos tratamentos do segundo experimento, com quatro repetições, porém as soluções foram depositadas sobre as folhas de plantas de Eichhornia crassipes. Foram adotados também os mesmos procedimentos de extração dos corantes após o término dos períodos de exposição. As soluções finais obtidas nos três estudos foram submetidas à leitura óptica de absorbância em espectrofotômetro UV-visível nos comprimentos de onda de 630 e 427 nm, para os corantes Azul Brilhante FDC-1 e Amarelo Tartrasina FDC-5, respectivamente. As várias concentrações das soluções de ambos os corantes não sofreram degradação pela luz solar quando submetidas aos vários períodos de incidência luminosa nos tubos de quartzo (ambiente fechado), visto que as curvas de recuperação apresentaram equações semelhantes àquelas concentrações que foram mantidas no escuro. A mesma estabilidade também foi observada quando os corantes foram submetidos à luz solar em ambiente aberto, ou seja, nas placas de Petri. O corante Amarelo Tartrasina também se apresentou muito estável quando depositado sobre as folhas de E. crassipes, independentemente da exposição ou não à luz solar. Para o corante Azul Brilhante, ocorreram significativas perdas de 7,8 e 18,6% quando esteve depositado na superfície da folha de aguapé pelo período de 10 horas sob condições de escuro e plena luz solar, respectivamente.

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Análise química da madeira e casca de diferentes tipos de eucalipto antes e durante o cultivo de shiitake em toras

Avaliaram-se a composição química da madeira e da casca de sete espécies (E. saligna E. grandis, E. urophylla, E. camaldulensis, E. citriodora, E. paniculata e E. pellita) e três clones de eucalipto (híbridos de E. grandis x E. urophylla), antes e durante o cultivo das linhagens LE-95/01 e LE-96/18 de shiitake (Lentinula edodes), em toras. Cada linhagem de shiitake foi inoculada em nove toras de cada tipo de eucalipto com 1 m de comprimento e 9 a 14 cm de diâmetro. Assim, o delineamento experimental foi inteiramente casualizado, com 20 tratamentos e nove repetições, sendo cada repetição correspondente a uma tora. As toras foram mantidas em estufa climatizada, com temperatura de 25 ºC ± 5 e umidade relativa do ar entre 60-80%, durante 12 meses. Para a determinação da composição química da madeira, analisaram-se cunhas de discos e cascas de eucalipto recém-cortadas (sem inoculação das linhagens de L. edodes) e cunhas de discos e cascas retirados de toras já inoculadas com as linhagens de L. edodes após oito meses de incubação. Os resultados mostraram diferenças nos teores de holocelulose, lignina e extrativos totais na madeira e casca após o corte e depois de oito meses de incubação nas espécies e clones de eucalipto; o maior índice de decomposição da holocelulose na madeira, ao longo do tempo, ocorreu no E. saligna (5,5%), indicando, assim, ser o mais favorável para o desenvolvimento micelial do L. edodes. Já na casca aconteceu no clone 24 (22,2%). O E. camaldulensis apresentou o maior índice de decomposição da lignina na madeira (6,8%), ao longo do tempo. Já na casca, entre os eucaliptos testados, o E. grandis sofreu a maior decomposição de lignina (21,9%); o L. edodes degradou muito mais a holocelulose e lignina da casca que da madeira, tornando evidente a importância da casca; a casca da maioria dos tipos de eucaliptos apresentou menor teor de holocelulose, maior teor de extrativos totais e teores de lignina semelhantes ou superiores quando comparados com a madeira. O fator tipo de eucalipto (espécies e clones) teve maior efeito que o fator linhagem de L. edodes na degradação da holocelulose e lignina.

The relationship between pasture degradation and soil properties in the Brazilian amazon: a case study

Pasture degradation is one of the greatest problems related to land use in the Amazon region, forcing farmers to open new forest areas. Many studies have identified the causes and the factors involved in this degradation process, in an attempt to reverse the situation. The purpose of this study was to examine the relationship between pasture degradation and some soil properties, to try to identify the most significant soil features in the degradation process. A cattle raising farm in the eastern Amazon region, with pastures of different ages and degrees of degradation, was used as the site for this study: a primary forest area, PN; three Guinea grass (Panicum maximum Jacq.) pastures in an increasingly degraded sequence-P1, P2 and P3; one Gamba grass (Andropogon gayanus Kunth) pasture following an extremely degraded Guinea grass pasture, P4. Aboveground phytomass data showed differences between the pastures, reflecting initially observed degradation levels. Grass biomass decreased sharply from P1 to P2 and disappeared at P3. Pasture recovery with Gamba grass at P4 was very successful, with grass biomass higher than P1 and weed biomass smaller than P2 and P3. Root biomass also decreased with pasture degradation. Soil bulk density increased with pasture decrease at the topsoil layer. Results from the soil chemical analysis showed that there were no signs of decrease in organic carbon and total nitrogen after the forest was transformed into pasture. In all pastures, degraded or not, the soil pH, the sum of bases and the saturation degree were higher than in the forest soil. The extractable phosphorus content, lower in forest soil, remained quite stable in pasture soils, but it could become a limiting factor for the maintenance of Guinea grass. Results indicated that pasture degradation does not seem to be directly related to the modification of the chemical features of soils. (C) 2004 Elsevier B.V. All rights reserved.

Lodo de esgoto na recuperação de áreas degradadas: efeito nas características físicas do solo

A recuperação de áreas degradadas é um processo lento e requer a adição de resíduos orgânicos como condicionador das propriedades físicas do solo. O lodo de esgoto apresenta elevados teores de matéria orgânica (MO) e nutrientes e, portanto, tem alto potencial para utilização nessas áreas. O objetivo deste trabalho foi verificar o efeito da adição de lodo de esgoto na recuperação das características físicas de um solo degradado (Neossolo Quartzarênico) plantado com espécies nativas da Mata Atlântica, na Fazenda Entre-Rios, pertencente à Cia. Suzano Bahia Sul de Papel e Celulose, na região de Itatinga-SP. O experimento foi conduzido em blocos casualizados com quatro repetições. Os tratamentos foram constituídos por seis doses de lodo de esgoto (0, 2,5, 5, 10, 15 e 20 t ha-1), mais um que recebeu a adubação química. A aplicação de lodo de esgoto, para recuperação de áreas degradadas, aumentou os agregados do solo conforme o aumento das doses de lodo, até 12 meses após sua aplicação. As porosidades (macro, micro e total) do solo foram aumentadas com as maiores doses de lodo de esgoto até seis meses após sua aplicação; apenas a microporosidade foi aumentada até 12 meses após a aplicação. Houve aumento da umidade do solo em função do aumento das doses de lodo no solo até seis meses após a aplicação.

Normas jurídicas para a restauração ecológica: uma barreira a mais a dificultar o êxito das iniciativas?

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Concepção e estudo de um biofiltro para tratamento de compostos orgânicos voláteis COVs

In the last decade, biological purification of gaseous waste has become an important alternative to many conventional methods of exhaust air treatment. More recently, biofiltration has proved to be an effective and inexpensive method for the treatment of air contaminated with volatile organic compounds (VOCs). A biofilter consists in a reactor packed with a porous solid bed material, where the microorganisms are fixed. During the biofiltration process, polluted air is transported through the biofilter medium where the contaminant is degraded. Within the biofilm, the pollutants in the waste gases are energy and carbon sources for microbial metabolism and are transformed into CO2, water and biomass. The bed material should be characterized by satisfactory mechanical and physical properties as structure, void fraction, specific area and flow resistance. The aim of this research was the biofilter construction and study of the biological degradation of ethanol and toluene, as well as the modeling of the process. Luffa cylindrica is a brazilian fiber that was used as the filtering material of the present work. The parameters and conditions studied were: composition of nutrients solution; effect of microflorae strains, namely Pseudomanas putida and Rhodococcus rhodochrous; waste gas composition; air flow rate; and inlet load of VOCs. The biofilter operated in diffusion regime and the best results for remotion capacity were obtained when a microorganisms consortion of Pseudomanas putida and Rhodococcus rhodochrous,were used, with a gas flow rate of 1 m3.h-1 and molar ratio nitrogene/phosphore N/P=2 in the nutrients solution. The maximum remotion capacity for ethanol was around 90 g.m-3.h-1 and 50 g.m-3.h-1 to toluene. It was proved that toluene has inhibitory effect on the ethanol remotion When the two VOCs were present in the same waste gas, there was a decrease of 40% in ethanol remotion capacity. Luffa cylindrica does not present considerable pressure drop. Ottengraf and van Lith models were used to represent the results obtained for ethanol and toluene, respectively. The application of the transient model indicated a satisfactory approximation between the experimental results obtained for ethanol and toluene vapors biofiltration and the ones predicted it

Mapeamento geoambiental do campo de dunas Pirangi-Potengi com ênfase a San Vale e Lagoinha Natal/RN: um instrumento de apoio ao planejamento ambiental

The city of Natal-RN is constructed on dune areas with wavy relives softly waved and green areas that help to keep a pleasant climate, amongst these is distinguished field Pirangi-Potengi the dune with the areas of San Vale and Lagoinha. These environments are being substituted gradual for property and other workmanships of engineering on behalf of the urban expansion. This study the elaboration of a geoambiental mapping of Field had as objective generality Pirangi-Potengi the Dune with emphasis the San Vale and Lagoinha in Natal-RN. The done mapping had as objective specific to elaborate a vegetation map, a map of registers in cadastre of ambient problems to dunes, a map of flooding susceptibility, a map of vulnerability to the underground water contamination and a map of use and occupation of the ground. Of the carried through analysis, the area in study reveals sufficiently degraded, remaining only few green areas and dunares, as well as, the vulnerable presence of areas of vulnerability in floods and areas the contamination of the water-bearing one. The gotten results allow to affirm that this type of mapping, is of great importance for analysis and evaluation of the environment of the city

Caracterização do lodo de lagoa anaeróbia tratando resíduos esgotados de tanques sépticos e fossas com vistas ao aproveitamento

The sludge generated in stabilization ponds can be designed for various purposes, among them we mention agricultural use, recovery of degraded areas and civil construction. The choice of these alternatives should be made based on qualitative and quantitative characteristics of the sludge. In this context, this study characterized the digested sludge from an anaerobic lagoon in Cidade do Natal/RN, which deals exclusively with residues of depleted septic tanks and pits. The sludge showed levels of macro and micronutrients that confirm its potential for agriculture, with 139.49 g.kg -1 organic matter, 15.40 g.kg-1 nitrogen and metal concentrations below those required by Resolution No. 375/06 of CONAMA, besides the absence of fecal coliform and less than 0.15 viable helminthes eggs/g, on average. The particle size distribution showed that most of the particles have a diameter similar to the sand, allowing the replacement of this input, for example. Analysis of the leachate and of the sludge solubilized classified as non-inert and non-hazardous according to NBR 10.004/04. The volume produced in three years of operation by the pond was 1903.50m³, equivalent to approximately 400 kg of dry sludge. Overall, the concentrations of the parameters were similar to literature, although none of them addresses sludge anaerobic pond treating sewer from septic tanks and pits.The sludgepresents technical feasibility to various types of use, however the cost of dewatering and especially with transport can derail it. It needs to be made a more thorough study of the costs to prove its economic viability

Análise do uso e ocupação do solo das margens de um reservatório e a sua influência na qualidade da água

The building of water reservoirs has become a solution for water scarcity of the semiarid regions, however, the land use and occupation near the margins of the reservoirs have been causing serious damage to water quality, harming their use. This paper aims to analyze the land use and occupation in the margins of the Northeast reservoir and evaluate their influence on the water quality, to identify the areas and activities that represent an higher risk of contamination to the reservoir. The study was conducted at the reservoir Dourado, located in the city of Currais Novos - RN, during the period from August 2012 to February 2013. Were defined six areas regarding the land use and occupation, then, Water samples were collected from the margins in these areas for the characterization of water quality. The results showed that almost all Permanent Preservation Areas (PPA) from the reservoir is degraded, increasing the susceptibility of large input of nutrients and contaminants loads. The water reservoir showed low quality, being with strong evidence of eutrophication due to the nutrient accumulation arising from the activities surrounding the reservoir, mainly from agriculture and Livestock. The Areas 1 and 2 are the areas that present a greater risk of reservoir degradation, because are the possible major sources of nutrients (phosphorus total, orthophosphate and nitrate), however, due to the small size of the reservoir, any compound that reaches its margins ultimately affects the water quality of the same

Water beetles in mountainous regions in southeastern Brazil

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Stochastic modelling considering ionospheric scintillation effects on GNSS relative and point positioning

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

The influence of preparation method of OC1OC6-PPV films on the photo-oxidation process

Poly(p-phenylene vinylene) (PPV) derivatives are well known for their applications in polymer light emitting diodes (PLEDs). PPV derivatives are highly susceptible to photo-oxidation though, which is mainly caused by the scission of the vinyl double bond on the polymer backbone. In this work, we show that Langmuir-Blodgett (LB) films are less degraded than cast films of a PPV derivative (OC1OC6-PPV). Both films had similar thickness (similar to 50 nm) to allow for a more realistic comparison. Degradation was monitored with UV-vis and FTIR spectroscopies. The results indicated that cast films were completely degraded in ca. 400 min, while LB took longer time, i.e. about four times the values for the cast films. The differences can be attributed to the more compact morphology in the LB than in the cast films. With a compact morphology the diffusion of oxygen in the LB film is hampered and this causes a delay in the degradation process. (c) 2006 Elsevier Ltd. All rights reserved.

Isolation, solubility and in vitro hydrolysis of chickpea vicilin-like protein

The chickpea vicilin-like globulin was isolated and chromatographed on Sepharose CL-6B and Sephacryl S-300. The native globulin with a molecular weight of 140 kDa was resolved in Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) in seven polypeptide bands in the range of 12.4-67 kDa. The solubility profile of the protein in water and NaCl solutions was typical of a legume globulin. The purified vicilin-like globulin, native and heated, was hydrolyzed by pepsin, trypsin and chymotrypsin. The hydrolysis patterns indicated that the native vicilin-like protein was only partially degraded by the enzymes in comparison with casein. Heating increased its susceptibility to hydrolysis relative to the native form, for all the enzymes. However, the results obtained by the pH-drop method revealed that the in vitro digestibility of the vicilin-like protein was not altered by heating, while 11 S-like and total globulins suffered a small increase, indicating that the structural characteristics of storage globulins may be important factors limiting the protein digestion. (c) 2007 Swiss Society of Food Science and Technology. Published by Elsevier Ltd. All rights reserved.

Heteroplasmy in hair: Differences among hair and blood from the same individuals are still a matter of debate

The analysis of mitochondrial DNA (mtDNA) is a useful tool in forensic cases when sample contents too little or degraded nuclear DNA to genotype by autosomal short tandem repeat (STR) loci, but it is especially useful when the only forensic evidence is a hair shaft. Several authors have related differences in mtDNA from different tissues within the same individual, with high frequency of heteroplasmic variants in hair, as also in some other tissues. Is still a matter of debate how the differences influence the interpretation forensic protocols. One difference between two samples supposed to be originated from the same individual are related to an inconclusive result, but depending on the tissue and the position of the difference it should have a different interpretation, based on mutation-rate heterogeneity of mtDNA. In order to investigate it differences in the mtDNA control region from hair hafts and blood in our population, sequences from the hypervariable regions 1 and 2 (HV1 and HV2) from 100 Brazilian unrelated individuals were compared. The frequency of point heteroplasmy observed in hair was 10.5% by sequencing. Our study confirms the results related by other authors that concluded that small differences within tissues should be interpreted with caution especially when analyzing hair samples. (C) 2007 Elsevier B.V.. All rights reserved.