Addiction protein Phd of plasmid prophage P1 is a substrate of the ClpXP serine protease of Escherichia coli.

Plasmid-encoded addiction genes augment the apparent stability of various low copy number bacterial plasmids by selectively killing plasmid-free (cured) segregants or their progeny. The addiction module of plasmid prophage P1 consists of a pair of genes called phd and doc. Phd serves to prevent host death when the prophage is retained and, should retention mechanisms fail, Doc causes death on curing. Doc acts as a cell toxin to which Phd is an antidote. In this study we show that host mutants with defects in either subunit of the ClpXP protease survive the loss of a plasmid that contains a P1 addiction module. The small antidote protein Phd is fully stable in these two mutant hosts, whereas it is labile in a wild-type host. We conclude that the role of ClpXP in the addiction mechanism of P1 is to degrade the Phd protein. This conclusion situates P1 among plasmids that elicit severe withdrawal symptoms and are able to do so because they encode both a cell toxin and an actively degraded macromolecule that blocks the synthesis or function of the toxin.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Search for very high energy gamma radiation from the radio bright region DR4 of the SNR G78.2+2.1

Data from the HEGRA air shower array are used to set an upper limit on the emission of gamma-radiation above 25 (18) TeV from the direction of the radio bright region DR4 within the SNR G78.2 + 2.1 of 2.5 (7.1). 10^-13 cm^-2 sec^-1. The shock front of SNR G78.2 + 2.1 probably recently overtook the molecular cloud Gong 8 which then acts as a target for the cosmic rays produced within the SNR, thus leading to the expectation of enhanced gamma-radiation. Using a model of Drury, Aharonian and Völk which assumes that SNRs are the sources of galactic cosmic rays via first order Fermi acceleration, we calculated a theoretical prediction for the gamma-ray flux from the DR4 region and compared it with our experimental flux limit. Our 'best estimate' value for the predicted flux lies a factor of about 18 above the upper limit for gamma-ray energies above 25 TeV. Possible reasons for this discrepancy are discussed.

The Keyes to Reclaiming the Racial History Of the Roberts Court

This article advocates for a fundamental re-understanding about the way that the history of race is understood by the current Supreme Court. Represented by the racial rights opinions of Justice John Roberts that celebrate racial progress, the Supreme Court has equivocated and rendered obsolete the historical experiences of people of color in the United States. This jurisprudence has in turn reified the notion of color-blindness, consigning racial discrimination to a distant and discredited past that has little bearing to how race and inequality is experienced today. The racial history of the Roberts Court is centrally informed by the context and circumstances surrounding Brown v. Board of Education. For the Court, Brown symbolizes all that is wrong with the history of race in the United States - legal segregation, explicit racial discord, and vicious and random acts of violence. Though Roberts Court opinions suggest that some of those vestiges still exits, the bulk of its jurisprudence indicate the opposite. With Brown’s basic factual premises as its point of reference, the Court has consistently argued that the nation has made tremendous strides away from the condition of racial bigotry, intolerance, and inequity. The article accordingly argues that the Roberts Court reliance on Brown to understand racial progress is anachronistic. Especially as the nation’s focus for racial inequality turned national in scope, the same binaries in Brown that had long served to explain the history of race relations in the United States (such as Black-White, North-South, and Urban-Rural) were giving way to massive multicultural demographic and geographic transformations in the United States in the years and decades after World War II. All of the familiar tropes so clear in Brown and its progeny could no longer fully describe the current reality of shifting and transforming patterns of race relations in the United States. In order to reclaim the history of race from the Roberts Court, the article assesses a case that more accurately symbolizes the recent history and current status of race relations today: Keyes v. School District No. 1. This was the first Supreme Court case to confront how the binaries of cases like Brown proved of little probative value in addressing how and in what ways race and racial discrimination was changing in the United States. Thus, understanding Keyesand the history it reflects reveals much about how and in what ways the Roberts Court should rethink its conclusions regarding the history of race relations in the United States for the last 60 years.

Internet Civil Liberties in the U.S. and the Protection of the Modern Terrorist

This capstone examines the civil liberties of the modern terrorist and explicates the right to freedom of speech for terrorist organizations and their use of the internet. Terrorist organizations use the internet to promote ideas, recruit members, organize the flow of information, and coordinate actions. During the war on terror the US Patriot Act became law allowing for U.S. government censorship and surveillance of internet traffic and many believe these acts are a threat to civil liberties. Terrorist organizations have the right to express their views, however unpopular, and censoring or restricting web sites diminishes civil liberties for all, which democracies and liberal societies are founded upon.

Paleogene evolution of the External Betic Zone and geodynamic implications

Interdisciplinary studies combining field data (geological and tectonic mapping, lithostratigraphic reconstructions, lithofacies characterization, correlations and sampling) and laboratory analyses (biostratigraphy, chronostratigraphy, clay mineralogy and sandstone petrography) of eight Senonian-Paleogene successions from the Sierra de La Pila and Sierra de El Carche areas (Murcia province, SE Spain) belonging to the External Betic Zone are presented. Field evidence of tectonic activity (slumps, olistostromes, syn-genetic folds, lateral variability, changes in thicknesses, para- and unconformity boundaries, stratigraphic gaps, shallowing upward trends to emersion, etc.) was found in several Paleogene intervals. The results enable a better reconstruction of the stratigraphic architecture and chronostratigraphy of the Paleogene record, highlighting in particular: facies evolution, discontinuities, depositional sequences (Middle-Upper Maastrichtian, Upper Paleocene-Middle Eocene, Oligocene-Lower Aquitanian), environmental evolution (homogeneous conditions during the Late Cretaceous and successive realm diversification from platform to slope to basin) and correlations, along the Prebetic to Subbetic transition, which is a key sector to understand the northeastward variations of the South Iberian margin. A conclusive paleogeographic and geodynamic evolutionary model for the study area is proposed, hypothesizing that Paleogene compressive tectonics affected the eastern External Betic Zone. In addition, correlations with successions from the western External Betic Zone evidenced asynchronous deformation from east to west along the internalmost External Betic Zone. Moreover, a comparison with the external Tunisian Tell enables the recognition of similar sedimentarytectonic events, imposing new constraints in the Paleogene geodynamic reconstruction throughout the western Tethys.

A discourse on natural religion: delivered in the Chapel of the University at Cambridge, September 5, 1787

The hand-sewn notebook contains a 35-page manuscript draft of the Dudleian lecture delivered by Simeon Howard on September 5, 1787 at Harvard College. The sermon begins with the Biblical text Acts 17:28. The copy includes a small number of edits and struck-out words. The covers are no longer with the item. The lecture was not printed.

A discourse on natural religion: delivered in the chapel of the University in Cambridge, September 3r, 1795, at the lecture founded by the Honourable Paul Dudley, Esqr

The hand-sewn notebook contains a manuscript draft of the Dudleian lecture delivered by Thomas Barnard on September 3, 1795 at Harvard College. The sermon begins with the Biblical text Acts 14-57. The copy includes a small number of edits and struck-out words. The covers are no longer with the item.

Iceland’s contested European Policy: The Footprint of the Past - A Small and Insular Society. Jean Monnet Occasional Paper 01/2013

Introduction. Iceland’s domestic politics and foreign affairs are undergoing drastic changes. After an economic crash, violent protests on the streets of Reykjavik for the first time in Iceland’s history contributed to the defeat of the government. The party system has been altered. A turn has been taken towards Europe after the United States left the island, first by closing its military base in 2006 and then by its clear stance not to assist the country in its economic difficulties. The former close relations with the superpower are unlikely ever to be restored. The EU membership application is placing severe constraints on political parties which are split on the issue and has put in jeopardy the unity of the first left majority in the Icelandic parliament, the Althingi. Society is in a state of flux after an unprecedented economic downscaling and the collapse of almost its entire financial sector – which had boomed rapidly beginning in the mid-1990s. The credibility of politicians, the parliament and the media is in ruins. Iceland’s smallness and its location on the geographical map – one could also say the geopolitical map – has had a profound influence on its domestic and foreign affairs. Iceland is closely associated with the other Nordic states and has adopted many of their domestic characteristics, with important exceptions. On the other hand, the country has come under American influence – geographically, it straddles the Mid-Atlantic rift – and has limited its participation in the European project. Its geographical location in the middle of the North Atlantic has led to a notion that the country’s culture is unique and should be protected by all available means. Politicians continue to play the ‘nationalistic uniqueness’ card with considerable success even though the country has been swept by globalization. Rapid modernization (which only really began in the Second World War with British and American occupations) and sudden engagement with the outside world (which only extended to the general public in the last quarter of the twentieth century) are still slowly but steadily making their mark on the country’s foreign policy. The country’s political discourse and foreign policy still bear the hallmark of the past, i.e. of a small and insular society This paper will address the political developments in Iceland since the 2008 economic crash and place it in a historical context. The aim is to understand Iceland’s present foreign policy and, in particular, the highly contested decision by its government in 2009 to apply for membership of the European Union. The paper is divided into five sections in addition to this introduction and the concluding remarks. First, it starts by explaining the importance in Iceland of a political discourse based on the concept of independence which dates back to the historical narrative of the settlement period. This section will also examine Iceland’s close relations with the other Nordic states – despite important differences between it and the others. Second, the paper will analyse the importance of the party system, i.e. the dominance of the centre-right in Icelandic politics, and the changed nature of the system. Third, it examines how Iceland further distinguishes itself from the other Nordic states in many important features. Fourthly, the paper analyses the country’s three main foreign policy priorities in the post-war period, i.e. extensions of the Exclusive Economic Zone, firm defence arrangements with the US and membership of NATO, and the drive for better market access for marine products – including a partial engagement in the European project. Fifthly, the paper examines how the country’s smallness, in terms of its central administrative capacity, has affected its domestic and foreign policy-making. The concluding section summarizes the main findings concerning the political and historical obstacles that the Social Democratic Alliance faces in its hard-fought battle to change the country’s European Policy.

Bosniacki chaos. Zrodla kryzysu politycznego we wspolczesnej Bosni i Hercegowinie. Prace OSW 31/2009. = Bosnia's chaos. Causes of the political crisis in Bosnia and Herzegovina today. OSW Study 31/2009

A new form of 'transformational crisis' has been observed in Bosnia and Herzegovina since at least 2005. Politicians representing the three major ethno-political communities (Bosnians, Croats and Serbs) have successively been raising disputes and have employed various political tools to preserve the conflicts instead of resolving them. As a result, the central state institutions and organisations have been weakened and attempts to replace them with narrower ethnic structures have been made. This is increasingly paralysing the state, thus impeding its everyday operation and preventing its structures and legislation from being modernised; had this been achieved, it would have resulted in a real acceleration of the process of Bosnia's integration with the EU and NATO. The present crisis is also an effect of the disagreement between the key international players - the European Union, the United States and Russia - over the 'plan for Bosnia' and the role and duties of the Office of the High Representative, who acts on behalf of the international community in the country.

The End of the Transitional Period for Police and Criminal Justice Measures Adopted before the Lisbon Treaty: Who monitors trust in the European Criminal Justice area? CEPS Liberty and Security in Europe No. 74, December 2014

This study examines the legal and political implications of the forthcoming end of the transitional period for the measures in the fields of police and judicial cooperation in criminal matters, as set out in Protocol 36 to the EU Treaties. This Protocol limits some of the most far-reaching innovations introduced by the Treaty of Lisbon over EU cooperation on Justice and Home Affairs for a period of five years after the entry into force of the Treaty of Lisbon (until 1 December 2014), and provides the UK with special ‘opt out/opt-in’ possibilities. The study focuses on the meaning of the transitional period for the wider European Criminal Justice area. The most far-reaching change emerging from the end of this transition will be the expansion of the European Commission and Luxembourg Court of Justice scrutiny powers over Member States’ implementation of EU criminal justice law. The possibility offered by Protocol 36 for the UK to opt out and opt back in to pre-Lisbon Treaty instruments poses serious challenges to a common EU area of justice by further institutionalising ‘over-flexible’ participation in criminal justice instruments. The study argues that in light of Article 82 TFEU the rights of the defence are now inextricably linked to the coherency and effective operation of the principle of mutual recognition of criminal decisions, and calls the European Parliament to request the UK to opt in EU Directives on suspects procedural rights as condition for the UK to ‘opt back in’ measures like the European Arrest Warrant.

The UN General Assembly Vote: Upgrading the Status of Palestine and Its Implications for a Possible Role of the ICC. IES Policy Brief Issue 2013/06 • June 2013

On 29 November 2012, the General Assembly of the United Nations (UN) voted overwhelmingly to accord Palestine ‘Non-Member Observer State’ Status in the UN. In the first part of this Policy Brief, the implications of upgrading the status of Palestine with regard to the possible role of the International Criminal Court (ICC) will be assessed. In April 2012, the Office of the Prosecutor of the ICC declined to accept jurisdiction for acts committed on the territory of Palestine since 1 July 2002, justifying its decision based on the fact that Palestine had, at the time, only the status of an ‘Observer Entity’ at the UN. Subsequently, it will be analysed if the Palestinian pursuit of its cause before the ICC can be considered as an effective lawfare strategy or rather as a poisoned chalice.

Strategic Insurance: The Future of the Belgian Armed Forces. IES Policy Brief Issue 2014/04/May 2014

Summary. Belgium is on the cusp of its next defence reform. While the security landscape throughout Europe’s neighbourhood and beyond deteriorates, the armed forces face numerous challenges. Most importantly, the next defence plan needs to recalibrate the force structure in function of political ambitions and budgetary realities. This Policy Brief argues that Belgium must embrace a nimble but broad-spectrum force. Any future structure must encompass agile land forces as well as a modern combat air force, without neglecting the need to safeguard a sizeable navy and invest in cyber capabilities. European cooperation should be pursued wherever possible while recognising that this necessitates budgetary convergence. For Belgium this means the investment budget needs to grow significantly in order to acquire interoperable but self-owned assets. Such a choice can be justified on the recognition that defence is not just about expeditionary operations, but also economic stimulus, intergenerational solidarity and strategic insurance: maintaining the ability to respond to whatever the future may bring.