Antenas de microfita com patch em anel e múltiplas camadas dielétricas anisotrópicas uniaxiais

This work presents an analysis of the annular ring microstrip antennas printed on uniaxial anisotropic substrates and with superstrate.The analysis uses the full-wave formulation by means of the Hertz vector potentials method, in the Hankel transform domain. The definition of the Hertz vector potentials and the application of the appropriate boundary conditions to the structure allow determining the dyadic Green functions, relating the current densities in the conducting patch to the transforms of the tangential electric field components. Galerkin s method is then used to obtain the matrix equation whose nontrivial solution gives the complex resonant frequency of the antenna. From the modeling, it is possible to obtain results for the resonant frequency, bandwidth and quality factor, as a function of several parameters of the antenna, for different configurations. We have considered annular ring microstrip antennas on a single dielectric layer, antennas with two anisotropic dielectric layers, and annular ring microstrip antennas on suspended substrates. Numerical results for the resonant frequency of the these structures printed on isotropic substrates are also presented and compared with those published by other authors, showing a good agreement

Desenvolvimento e testes de software de um receptor de GPS para uso espacial

Spacecraft move with high speeds and suffer abrupt changes in acceleration. So, an onboard GPS receiver could calculate navigation solutions if the Doppler effect is taken into consideration during the satellite signals acquisition and tracking. Thus, for the receiver subject to such dynamic cope these shifts in the frequency signal, resulting from this effect, it is imperative to adjust its acquisition bandwidth and increase its tracking loop to a higher order. This paper presents the changes in the GPS Orion s software, an open architecture receiver produced by GEC Plessey Semiconductors, nowadays Zarlink, in order to make it able to generate navigation fix for vehicle under high dynamics, especially Low Earth Orbit satellites. GPS Architect development system, sold by the same company, supported the modifications. Furthermore, it presents GPS Monitor Aerospace s characteristics, a computational tool developed for monitoring navigation fix calculated by the GPS receiver, through graphics. Although it was not possible to simulate the software modifications implemented in the receiver in high dynamics, it was observed that the receiver worked in stationary tests, verified also in the new interface. This work also presents the results of GPS Receiver for Aerospace Applications experiment, achieved with the receiver s participation in a suborbital mission, Operation Maracati 2, in December 2010, using a digital second order carrier tracking loop. Despite an incident moments before the launch have hindered the effective navigation of the receiver, it was observed that the experiment worked properly, acquiring new satellites and tracking them during the VSB-30 rocket flight.

Compressão auto-adaptativa de imagens coloridas

Image compress consists in represent by small amount of data, without loss a visual quality. Data compression is important when large images are used, for example satellite image. Full color digital images typically use 24 bits to specify the color of each pixel of the Images with 8 bits for each of the primary components, red, green and blue (RGB). Compress an image with three or more bands (multispectral) is fundamental to reduce the transmission time, process time and record time. Because many applications need images, that compression image data is important: medical image, satellite image, sensor etc. In this work a new compression color images method is proposed. This method is based in measure of information of each band. This technique is called by Self-Adaptive Compression (S.A.C.) and each band of image is compressed with a different threshold, for preserve information with better result. SAC do a large compression in large redundancy bands, that is, lower information and soft compression to bands with bigger amount of information. Two image transforms are used in this technique: Discrete Cosine Transform (DCT) and Principal Component Analysis (PCA). Primary step is convert data to new bands without relationship, with PCA. Later Apply DCT in each band. Data Loss is doing when a threshold discarding any coefficients. This threshold is calculated with two elements: PCA result and a parameter user. Parameters user define a compression tax. The system produce three different thresholds, one to each band of image, that is proportional of amount information. For image reconstruction is realized DCT and PCA inverse. SAC was compared with JPEG (Joint Photographic Experts Group) standard and YIQ compression and better results are obtain, in MSE (Mean Square Root). Tests shown that SAC has better quality in hard compressions. With two advantages: (a) like is adaptive is sensible to image type, that is, presents good results to divers images kinds (synthetic, landscapes, people etc., and, (b) it need only one parameters user, that is, just letter human intervention is required

Aplicação do método LTT às estruturas retangulares e triangulares em multicamadas e empilhadas em substratos PBG para comunicações móveis

Recently the planar antennas have been studied due to their characteristics as well as the advantages that they offers when compared with another types of antennas. In the mobile communications area, the need for this kind of antennas have became each time bigger due to the intense increase of the mobile communications that needs of antennas which operate in multifrequency and wide bandwidth. The microstrip antennas presents narrow bandwidth due the loss in the dielectric generated by radiation. Another limitation is the radiation pattern degradation due the generation of surface waves in the substrate. In this work some used techniques to minimize the disadvantages (previously mentioned) of the use of microstrip antennas are presented, those are: substrates with PBG material - Photonic Bandgap, multilayer antennas and with stacked patches. The developed analysis in this work used the TTL - Transverse Transmission Line method in the domain of Fourier transform, that uses a component of propagation in the y direction (transverse to the direction real of propagation z), treating the general equations of electric and magnetic field as functions of y and y . This work has as objective the application of the TTL method to microstrip structures with single and multilayers of rectangular and triangular patches, to obtaining the resonance frequency and radiation pattern of each structure. This method is applied for the treatment of the fields in stacked structures. The Homogenization theory will be applied to obtaining the effective permittivity for s and p polarizations of the substrate composed of PBG material. Numerical results for the triangular and rectangular antennas with single layer, multilayers resonators with triangular and rectangular patches are presented (in photonic and isotropic substrates). Conclusions and suggestions for continuity of this work are presented

Antenas planares integradas com FSSs para aplicações em sistemas de comunicações sem fio

This work presents a theoretical and experimental analysis about the properties of microstrip antennas with integrated frequency selective surfaces (Frequency Selective Surface - FSS). The integration occurs through the insertion of the FSS on ground plane of microstrip patch antenna. This integration aims to improve some characteristics of the antennas. The FSS using patch-type elements in square unit cells. Specifically, the simulated results are obtained using the commercial computer program CST Studio Suite® version 2011. From a standard antenna, designed to operate in wireless communication systems of IEEE 802.11 a / b / g / n the dimensions of the FSS are varied to obtain an optimization of some antenna parameters such as impedance matching and selectivity in the operating bands. After optimization of the investigated parameters are built two prototypes of microstrip patch antennas with and without the FSS ground plane. Comparisons are made of the results with the experimental results by 14 ZVB network analyzer from Rohde & Schwarz ®. The comparison aims to validate the simulations performed and show the improvements obtained with the FSS in integrated ground plane antenna. In the construction of prototypes, we used dielectric substrates of the type of Rogers Corporation RT-3060 with relative permittivity equal to 10.2 and low loss tangent. Suggestions for continued work are presented

Estudo avaliativo de um algoritmo genético auto-organizável e multiobjetivo utilizando aprendizado de máquina para aplicações de telecomunicações

This paper presents an evaluative study about the effects of using a machine learning technique on the main features of a self-organizing and multiobjective genetic algorithm (GA). A typical GA can be seen as a search technique which is usually applied in problems involving no polynomial complexity. Originally, these algorithms were designed to create methods that seek acceptable solutions to problems where the global optimum is inaccessible or difficult to obtain. At first, the GAs considered only one evaluation function and a single objective optimization. Today, however, implementations that consider several optimization objectives simultaneously (multiobjective algorithms) are common, besides allowing the change of many components of the algorithm dynamically (self-organizing algorithms). At the same time, they are also common combinations of GAs with machine learning techniques to improve some of its characteristics of performance and use. In this work, a GA with a machine learning technique was analyzed and applied in a antenna design. We used a variant of bicubic interpolation technique, called 2D Spline, as machine learning technique to estimate the behavior of a dynamic fitness function, based on the knowledge obtained from a set of laboratory experiments. This fitness function is also called evaluation function and, it is responsible for determining the fitness degree of a candidate solution (individual), in relation to others in the same population. The algorithm can be applied in many areas, including in the field of telecommunications, as projects of antennas and frequency selective surfaces. In this particular work, the presented algorithm was developed to optimize the design of a microstrip antenna, usually used in wireless communication systems for application in Ultra-Wideband (UWB). The algorithm allowed the optimization of two variables of geometry antenna - the length (Ls) and width (Ws) a slit in the ground plane with respect to three objectives: radiated signal bandwidth, return loss and central frequency deviation. These two dimensions (Ws and Ls) are used as variables in three different interpolation functions, one Spline for each optimization objective, to compose a multiobjective and aggregate fitness function. The final result proposed by the algorithm was compared with the simulation program result and the measured result of a physical prototype of the antenna built in the laboratory. In the present study, the algorithm was analyzed with respect to their success degree in relation to four important characteristics of a self-organizing multiobjective GA: performance, flexibility, scalability and accuracy. At the end of the study, it was observed a time increase in algorithm execution in comparison to a common GA, due to the time required for the machine learning process. On the plus side, we notice a sensitive gain with respect to flexibility and accuracy of results, and a prosperous path that indicates directions to the algorithm to allow the optimization problems with "η" variables

Caracterização de superfícies seletivas de freqüência e de antenas fractais para aplicações em redes sem fio

This work aims to investigate the behavior of fractal elements in planar microstrip structures. In particular, microstrip antennas and frequency selective surfaces (FSSs) had changed its conventional elements to fractal shapes. For microstrip antennas, was used as the radiating element of Minkowski fractal. The feeding method used was microstrip line. Some prototypes were built and the analysis revealed the possibility of miniaturization of structures, besides the multiband behavior, provided by the fractal element. In particular, the Minkowski fractal antenna level 3 was used to exploit the multiband feature, enabling simultaneous operation of two commercial tracks (Wi-Fi and WiMAX) regulated by ANATEL. After, we investigated the effect of switches that have been placed on the at the pre-fractal edges of radiating element. For the FSSs, the fractal used to elements of FSSs was Dürer s pentagon. Some prototypes were built and measured. The results showed a multiband behavior of the structure provided by fractal geometry. Then, a parametric analysis allowed the analysis of the variation of periodicity on the electromagnetic behavior of FSS, and its bandwidth and quality factor. For numerical and experimental characterization of the structures discussed was used, respectively, the commercial software Ansoft DesignerTM and a vector network analyzer, Agilent N5230A model

Estudo de Superfícies Seletivas de Frequência com o Uso de Inteligência Computacional

The main objective of this work is to optimize the performance of frequency selective surfaces (FSS) composed of crossed dipole conducting patches. The optimization process is performed by determining proper values for the width of the crossed dipoles and for the FSS array periodicity, while the length of the crossed dipoles is kept constant. Particularly, the objective is to determine values that provide wide bandwidth using a search algorithm with representation in bioinspired real numbers. Typically FSS structures composed of patch elements are used for band rejection filtering applications. The FSS structures primarily act like filters depending on the type of element chosen. The region of the electromagnetic spectrum chosen for this study is the one that goes from 7 GHz to 12 GHz, which includes mostly the X-band. This frequency band was chosen to allow the use of two X-band horn antennas, in the FSS measurement setup. The design of the FSS using the developed genetic algorithm allowed increasing the structure bandwidth

Método dinâmico aplicado para antenas cilíndricas

Nowadays there has been a major breakthrough in the aerospace area, with regard to rocket launches to research, experiments, telemetry system, remote sensing, radar system (tracking and monitoring), satellite communications system and insertion of satellites in orbit. This work aims at the application of a circular cylindrical microstrip antenna, ring type, and other cylindrical rectangular in structure of a rocket or missile to obtain telemetry data, operating in the range of 2 to 4 GHz, in S-band. Throughout this was developed just the theoretical analysis of the Transverse transmission line method which is a method of rigorous analysis in spectral domain, for use in rockets and missiles. This analyzes the spread in the direction "ρ" , transverse to dielectric interfaces "z" and "φ", for cylindrical coordinates, thus taking the general equations of electromagnetic fields in function of e [1]. It is worth mentioning that in order to obtain results, simulations and analysis of the structure under study was used HFSS program (High Frequency Structural Simulator) that uses the finite element method. With the theory developed computational resources were used to obtain the numerical calculations, using Fortran Power Station, Scilab and Wolfram Mathematica ®. The prototype was built using, as a substrate, the ULTRALAM ® 3850, of Rogers Corporation, and an aluminum plate as a cylindrical structure used to support. The agreement between the measured and simulated results validate the established processes. Conclusions and suggestions are presented for continuing this work

Estratégia de controle robusto para interconexão de sistemas PV trifásicos à rede elétrica

Atualmente há uma grande preocupação em relação a substituição das fontes não renováveis pelas fontes renováveis na geração de energia elétrica. Isto ocorre devido a limitação do modelo tradicional e da crescente demanda. Com o desenvolvimento dos conversores de potência e a eficácia dos esquemas de controle, as fontes renováveis têm sido interligadas na rede elétrica, em um modelo de geração distribuída. Neste sentido, este trabalho apresenta uma estratégia de controle não convencional, com a utilização de um controlador robusto, para a interconexão de sistemas fotovoltaicos com à rede elétrica trifásica. A compensação da qualidade de energia no ponto de acoplamento comum (PAC) é realizada pela estratégia proposta. As técnicas tradicionais utilizam detecção de harmônicos, já neste trabalho o controle das correntes é feita de uma forma indireta sem a necessidade desta detecção. Na estratégia indireta é de grande importância que o controle da tensão do barramento CC seja efetuado de uma forma que não haja grandes flutuações, e que a banda passante do controlador em regime permanente seja baixa para que as correntes da rede não tenham um alto THD. Por este motivo é utilizado um controlador em modo dual DSM-PI, que durante o transitório se comporta como um controlador em modo deslizante SM-PI, e em regime se comporta como um PI convencional. A corrente é alinhada ao ângulo de fase do vetor tensão da rede elétrica, obtido a partir do uso de um PLL. Esta aproximação permite regular o fluxo de potência ativa, juntamente com a compensação dos harmônicos e também promover a correção do fator de potência no ponto de acoplamento comum. Para o controle das correntes é usado um controlador dupla sequencia, que utiliza o princípio do modelo interno. Resultados de simulação são apresentados para demonstrar a eficácia do sistema de controle proposto

Arquiteturas eficientes para sensoriamento espectral e classificação automática de modulações usando características cicloestacionárias

The increasing demand for high performance wireless communication systems has shown the inefficiency of the current model of fixed allocation of the radio spectrum. In this context, cognitive radio appears as a more efficient alternative, by providing opportunistic spectrum access, with the maximum bandwidth possible. To ensure these requirements, it is necessary that the transmitter identify opportunities for transmission and the receiver recognizes the parameters defined for the communication signal. The techniques that use cyclostationary analysis can be applied to problems in either spectrum sensing and modulation classification, even in low signal-to-noise ratio (SNR) environments. However, despite the robustness, one of the main disadvantages of cyclostationarity is the high computational cost for calculating its functions. This work proposes efficient architectures for obtaining cyclostationary features to be employed in either spectrum sensing and automatic modulation classification (AMC). In the context of spectrum sensing, a parallelized algorithm for extracting cyclostationary features of communication signals is presented. The performance of this features extractor parallelization is evaluated by speedup and parallel eficiency metrics. The architecture for spectrum sensing is analyzed for several configuration of false alarm probability, SNR levels and observation time for BPSK and QPSK modulations. In the context of AMC, the reduced alpha-profile is proposed as as a cyclostationary signature calculated for a reduced cyclic frequencies set. This signature is validated by a modulation classification architecture based on pattern matching. The architecture for AMC is investigated for correct classification rates of AM, BPSK, QPSK, MSK and FSK modulations, considering several scenarios of observation length and SNR levels. The numerical results of performance obtained in this work show the eficiency of the proposed architectures

Utilização da lógica difusa no controle inteligente de sistemas eletro-hidráulicos

Electro-hydraulic servo-systems are widely employed in industrial applications such as robotic manipulators, active suspensions, precision machine tools and aerospace systems. They provide many advantages over electric motors, including high force to weight ratio, fast response time and compact size. However, precise control of electro-hydraulic systems, due to their inherent nonlinear characteristics, cannot be easily obtained with conventional linear controllers. Most flow control valves can also exhibit some hard nonlinearities such as deadzone due to valve spool overlap on the passage´s orifice of the fluid. This work describes the development of a nonlinear controller based on the feedback linearization method and including a fuzzy compensation scheme for an electro-hydraulic actuated system with unknown dead-band. Numerical results are presented in order to demonstrate the control system performance

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Avaliação de dois clones de Escherichia coli recombinante quanto ao crescimento e expressão de antígenos de Leishmania chagasi (kmp11 e P36)

Visceral leishmaniosis caused by Leishmania chagasi, also known as calazar, presented, in the period from 1990 to 2005, tax of incidence in Brazil varying between 1 and 3 cases for 100 000 inhabitants. The Northeast region that up to the year of 2000 contributed with almost 90% of the registered cases is reducing his participation in the current decade, reaching 56% in 2005. Conventional leishmaniasis treatment is costly and it shows high toxicity, demanding more research for alternative treatments, with special interest in development of vaccines and diagnosis kits which include production of recombinant antigens by host cells. Escherichia coli has been the microorganism most studied and used as a host for recombinant protein production. Therefore, the aim of this work was to study the influence of induction on cellular growth and to verify the type of Leishmania chagasi antigens expression (intra or extracellular) during two recombinant E. coli clones (kmp11 and P36) cultivation in rotary incubator (shaker) using three different media (2xTY, TB, FASS+EL). For that, tests were carried out using conditions established in the literature for E. coli (37°C and 200 rpm) and media supplemented with antibiotics to guarantee that only competent cells grows. First, tests were carried out without induction in order to verify the two microorganisms kinetic behavior (growth and substrate consumption) in different media. Next, the induction was carried out through the addition of IPTG (1mM as final concentration), at the first hour of cultivation. It was observed that protein expression were intracellular for all clones and media tested, however the highest level of expression was clearly observed by the electrophoresis band density (intensity) for 2xTY medium and kmp11 protein. Although it contains the lowest substrate concentration, consequently, a reduced cellular concentration when compared to other media, it appeared that this medium and clone combination is the most indicated for recombinant protein production. Therefore, the objective of this work was achieved, since the interested proteins were produced. Consequently, this result motivates new studies for production optimization using different cultivation strategies

Registro semiautomático entre imagens infravermelhas e RGB coletadas por um par de câmaras digitais

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)