Innovative Leak Test for Pavement Joint Seals, Progress Report, HR-318, 1993

Premature failure of concrete pavement contraction joint seals is an ongoing and costly problem for the Iowa Department of Transportation. Several joint seal test sections consisting of variations in sawing methods, joint cleaning techniques, sealant installation, and sealant types have been established over the past few years. Laboratory analysis and field inspections were done as a part of the tests, and core samples were taken for laboratory adhesion pull tests. Such methods often cover specifically small areas and may not expose hidden failures. Some tests are also labor-intensive and destructive, especially that of coring. An innovative, nondestructive, broad coverage joint seal tester that yields quick results has been designed and developed for evaluation of pavement joint seal performance. The Iowa vacuum joint seal tester (IA-VAC) applies a low vacuum above a joint seal that has been spray-covered with a foaming water solution. Any unsealed area or leak that exists along the joint will become quickly and clearly visible by the development of bubbles at the leak point. By analyzing the results from the IA-VAC tests, information on the number and types of leaks can be obtained; such information will help identify the source of the problem and direct efforts toward a solution.

A Study of the Reliability of the ASTM C-666 Freeze-Thaw Test, MLR-72-01 and R-252, 1972

The Iowa State Highway Commission purchased a Conrad automatic freeze and thaw machine and placed it in operation during October 1961. There were a few problems, but considering, the many electrical and mechanical devices used in the automatic system it has always functioned quite well. Rapid freezing and thawing of 4"x4"xl8" concrete beams has been conducted primarily in accordance with ASTM C-29l (now ASTM C-666 procedure B) at the rate of one beam per day. Over 4000 beams have been tested since 1961, with determination of the resulting durability factors. Various methods of curing were used and a standard 90 day moist cure was selected. This cure seemed to yield durability factors that correlated very well with ratings of coarse aggregates based on service records. Some concrete beams had been made using the same coarse aggregate and the durability factors compared relatively well with previous tests. Durability factors seemed to yield reasonable results until large variations in durability factors were noted from beams of identical concrete mix proportions in research projects R-234 and R-247. This then presents the question "How reliable is the durability as determined by ASTM C-666?" This question became increasingly more important when a specification requiring a minimum durability factor for P.C. concrete made from coarse aggregates was incorporated into the 1972 Standard Specification for coarse aggregates for concrete.

Which anatomical sites should be sampled for screening of methicillin-resistant Staphylococcus aureus carriage by culture or by rapid PCR test?

The nose is the anatomical site usually recommended for methicillin-resistant Staphylococcus aureus (MRSA) screening. Other sites are also recommended, but are more controversial. We showed that the sensitivities of MRSA detection from nasal swabs alone were 48% and 62% by culture or by rapid PCR test, respectively. These percentages increased to 79% and 92% with the addition of groin swabs, and to 96% and 99% with the addition of groin and throat swabs. In conclusion, neither by culture nor by rapid PCR test is nose sampling alone sufficient for MRSA detection. Additional anatomical sites should include at least the groin and throat.

Evaluation of the Duggan Test for Concretes Made of Different Types of Cements, MLR-97-8, 2000

In searching for simple and reliable test methods to evaluate the quality of Iowa portland cement concrete (PCC) pavements, the Duggan test was conducted for concretes made of twenty-six types of cements in this laboratory research. The influence of some factors, such as chemical composition and type of cements, use of air-entraining agent and water reducer, and water to cement ratio, on the result of the Duggan test was examined. It was found that the expansion increases with increasing values of potassium alkali (K2O) and sulfur trioxide (SO3) in cements. It was also found that the Type I cements generally produce higher expansion than the Type II, IP and IS cements. Since it is difficult to identify the major mechanism leading to the expansion observed in the Duggan test, more studies are certainly needed before it can be used as a reliable test method for evaluating the service life of concrete pavement.

Phosphorus in Finnish soils in the 1900s with particular reference to the acid ammonium acetate soil test

Selostus: Suomen maaperän fosforin tutkiminen 1900-luvulla ja viljavuustutkimuksen kehittäminen

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Accelerated Testing Track, HR-7, 1951

In May 1950 a proposal for a research project was submitted to the newly formed Iowa Highway Research Board for consideration and action. This project, designated RPSl by the Board, encompassed the study, development, preparation of preliminary plans and specifications for the construction of a wheel track to be used in the accelerated testing of highway pavements. The device envisioned in the proposal was a circular track about seventy-five feet in diameter equipped with a suitable automobile-tired device to test pavements about five feet in width laid into the track under regular construction practices by small scale construction equipment. The Board, upon review, revised and expanded the basic concepts of the project. The project as revised by the Board included a study of the feasibility of developing, constructing and operating an accelerated testing track in which pavements, bases and subgrades may be laid one full lane, or at least ten feet, in width by full size construction equipment in conformity with usual construction practices. The pavements so laid are to be subjected, during test, to conditions as nearly simulating actual traffic as possible.

Design and Operation of the Traffic Simulator, HR-100, 1967

Heavy traffic volumes frequently cause distress in asphalt pavements which were designed under accepted design methods and criteria. The distress appears in the form of rutting in the wheel tracks and rippling or shoving in areas where traffic accelerates or decelerates. Apparently accepted stability test methods alone do not always assure the desired service performance of asphaltic pavements under heavy traffic. The Bituminous Research Laboratory, Engineering Research Institute of Iowa State University undertook the development of a laboratory device by which the resistance of an asphalt paving mix to displacement under traffic might be evaluated, and also be used as a supplemental test to determine adequacy of design of the mix by stability procedures.

An Evaluation of the Consolidation Monitoring Device, HR-1013, 1978

The Iowa Department of Transportation research project HR-1013 is the evaluation of a prototype continuous monitoring nuclear density unit. The Unit, the Consolidation Monitoring Device (CMD), mounts on the rear of a slip-form paver and measures the density of the concrete while still in the plastic state. The evaluation performed determined the usefulness, accuracy, precision and reproducibility of the unit. The CMD was calibrated and tested in the laboratory for one week before field evaluation. The field evaluation consisted of monitoring at least 5 miles of paving and then correlating the CMD data with two conventional density methods. The two supplemental methods were density measurement with a Troxler nuclear gauge and densities obtained from core samples.

Smart suction device for less blood trauma: a comparison with Cell Saver.

OBJECTIVE: The major source of hemolysis during cardiopulmonary bypass remains the cardiotomy suction and is primarily due to the interaction between air and blood. The Smart suction system involves an automatically controlled aspiration designed to avoid the mixture of blood with air. This study was set-up to compare this recently designed suction system to a Cell Saver system in order to investigate their effects on blood elements during prolonged intrathoracic aspiration. METHODS: In a calf model (n=10; mean weight, 69.3+/-4.5 kg), a standardized hole was created in the right atrium allowing a blood loss of 100 ml/min, with a suction cannula placed into the chest cavity into a fixed position during 6 h. The blood was continuously aspirated either with the Smart suction system (five animals) or the Cell Saver system (five animals). Blood samples were taken hourly for blood cell counts and biochemistry. RESULTS: In the Smart suction group, red cell count, plasma protein and free hemoglobin levels remained stable, while platelet count exhibited a significant drop from the fifth hour onwards (prebypass: 683+/-201*10(9)/l, 5 h: 280+/-142*10(9)/l, P=0.046). In the Cell Saver group, there was a significant drop of the red cell count from the third hour onwards (prebypass: 8.6+/-0.9*10(12)/l, 6 h: 6.3+/-0.4*10(12)/l, P=0.02), of the platelet count from the first hour onwards (prebypass: 630+/-97*10(9)/l, 1 h: 224+/-75*10(9)/l, P<0.01), and of the plasma protein level from the first hour onwards (prebypass: 61.7+/-0.6 g/l, 1 h: 29.3+/-9.1 g/l, P<0.01). CONCLUSIONS: In this experimental set-up, the Smart suction system avoids damage to red cells and affects platelet count less than the Cell Saver system which induces important blood cell destruction, as any suction device mixing air and blood, as well as severe hypoproteinemia with its metabolic, clotting and hemodynamic consequences.

Laparoscopic Gastric Banding Outcomes Do Not Depend on Device or Technique. Long-Term Results of a Prospective Randomized Study Comparing the Lapband® and the SAGB®.

BACKGROUND: Gastric banding still represents one of the most widely used bariatric procedures. It provides acceptable weight loss in many patients, but has frequent long-term complications. Because different types of bands may lead to different results, we designed a randomized study to compare the Lapband® with the SAGB®. We hereby report on the long-term results. METHODS: Between December 1998 and June 2002, 180 morbidly obese patients were randomized between Lapband® or SAGB®. Weight loss, long-term morbidity, and need for reoperation were evaluated. RESULTS: Long-term weight loss did not differ between the two bands. Patients who maintained their band had an acceptable long-term weight loss of between 50 and 60 % EBMIL. In both groups, about half the patients developed long-term complications, with about 50 % requiring major redo surgery. There was no difference in the overall rates of long-term complications or failures between the two groups, but patients who had a Lapband® were significantly more prone to develop band slippage/pouch dilatation (13.3 versus 0 %, p < 0,001). CONCLUSIONS: Although in the absence of complication, gastric banding leads to acceptable weight loss; the long-term complication and major reoperation rates are very high independently from the type of band used or on the operative technique. Gastric banding leads to relatively poor overall long-term results and therefore should not be considered the procedure of choice for the treatment of morbid obesity. Patients should be informed of the limited overall weight loss and the very high complication rates.

Development of a Durability Test for Asphalts, May 1972

Research Project HR-124, "Development of a Laboratory Durability Test for Asphalts," was initiated in 1966 as a long-range comprehensive program. Its ultimate objective was to develop a simple, rapid laboratory test that could be used by highway engineers to select paving asphalt according to quality, to identify inferior asphalts, and to reasonably predict the useful life of asphalts once they were incorporated in the pavements.

Effects of alternative sets of climatic predictors on species distribution models and associated estimates of extinction risk: a test with plants in an arid environment

Aim To evaluate the effects of using distinct alternative sets of climatic predictor variables on the performance, spatial predictions and future projections of species distribution models (SDMs) for rare plants in an arid environment. . Location Atacama and Peruvian Deserts, South America (18º30'S - 31º30'S, 0 - 3 000 m) Methods We modelled the present and future potential distributions of 13 species of Heliotropium sect. Cochranea, a plant group with a centre of diversity in the Atacama Desert. We developed and applied a sequential procedure, starting from climate monthly variables, to derive six alternative sets of climatic predictor variables. We used them to fit models with eight modelling techniques within an ensemble forecasting framework, and derived climate change projections for each of them. We evaluated the effects of using these alternative sets of predictor variables on performance, spatial predictions and projections of SDMs using Generalised Linear Mixed Models (GLMM). Results The use of distinct sets of climatic predictor variables did not have a significant effect on overall metrics of model performance, but had significant effects on present and future spatial predictions. Main conclusion Using different sets of climatic predictors can yield the same model fits but different spatial predictions of current and future species distributions. This represents a new form of uncertainty in model-based estimates of extinction risk that may need to be better acknowledged and quantified in future SDM studies.