Association of tumor necrosis factor-alpha polymorphisms and ozone-induced change in lung function

Ozone is a major air pollutant with adverse health effects which exhibit marked inter-individual variability. In mice, regions of genetic linkage with ozone-induced lung injury include the tumor necrosis factor-alpha (TNF), lymphotoxin-alpha (LTA), Toll-like receptor 4 (TLR4), superoxide dismutase (SOD2), and glutathione peroxidase (GPX1) genes. We genotyped polymorphisms in these genes in 51 individuals who had undergone ozone challenge. Mean change in FEV1 with ozone challenge, as a percentage of baseline, was -3% in TNF -308G/A or A/A individuals, compared with -9% in G/G individuals (p = 0.024). When considering TNF haplotypes, the smallest change in FEV1 with ozone exposure was associated with the TNF haplotype comprising LTA +252G/TNF -1031T/TNF -308A/TNF -238G. This association remained statistically significant after correction for age, sex, disease, and ozone concentration (p = 0.047). SOD2 or GPX1 genotypes were not associated with lung function, and the TLR4 polymorphism was too infrequent to analyze. The results of this study support TNF as a genetic factor for susceptibility to ozone-induced changes in lung function in humans, and has potential implications for stratifying health risks of air pollution.

Social Wasp Diversity (Vespidae, Polistinae) in a Forest Fragment in the Northeast of Sao Paulo State Sampled with Different Methodologies

Social wasp diversity in Semideciduous Seasonal Forests of the northeast of Sao Paulo State is poorly known, causing a lack of information on the diversity of these wasps from these areas which have been degraded. The objective of this work was to evaluate the social wasp (Vespidae, Polistinae) diversity in a Semideciduous Seasonal Forest of the northeast of Sao Paulo State and to compare three different kinds of sampling methodology. Surveys were conducted from August 2005 to September 2006 in the interior, edge and matrix of a Semideciduous Seasonal Forest fragment in Patrocinio Paulista city, Sao Paulo State. Three methodologies were used: 1. Active collection in flowers, 2. Searching for nests, 3. Active collection with attractive liquid. Thirty species of social wasps were collected in the fragment, but the diversity was highest in the edge. Active collection with attractive liquid was the most efficient methodology. Despite the high levels of deforestation, forest fragments in Sao Paulo State have a high diversity of social wasps, reinforcing the importance of their preservation.

Mutations of the KISS1 Gene in Disorders of Puberty

Context: Kisspeptin, encoded by the KISS1 gene, is a key stimulatory factor of GnRH secretion and puberty onset. Inactivating mutations of its receptor (KISS1R) cause isolated hypogonadotropic hypogonadism (IHH). A unique KISS1R-activating mutation was described in central precocious puberty (CPP). Objective: Our objective was to investigate KISS1 mutations in patients with idiopathic CPP and normosmic IHH. Patients: Eighty-three children with CPP (77 girls) and 61 patients with IHH (40 men) were studied. The control group consisted of 200 individuals with normal pubertal development. Methods: The promoter region and the three exons of KISS1 were amplified and sequenced. Cells expressing KISS1R were stimulated with synthetic human wild-type or mutant kisspeptin-54 (kp54), and inositol phosphate accumulation was measured. In a second set of experiments, kp54 was preincubated in human serum before stimulation of the cells. Results: Two novel KISS1 missense mutations, p.P74S and p.H90D, were identified in three unrelated children with idiopathic CPP. Both mutations were absent in 400 control alleles. The p.P74S mutation was identified in the heterozygous state in a boy who developed CPP at 1 yr of age. The p.H90D mutation was identified in the homozygous state in two unrelated girls with CPP. In vitro studies revealed that the capacity of the P74S and H90D mutants to stimulate IP production was similar to the wild type. After preincubation of wild-type and mutant kp54 in human serum, the capacity to stimulate signal transduction was significantly greater for P74S compared with the wild type, suggesting that the p.P74S variant is more stable. Only polymorphisms were found in the IHH group. Conclusion: Two KISS1 mutations were identified in unrelated patients with idiopathic CPP. The p.P74S variant was associated with higher kisspeptin resistance to degradation in comparison with the wild type, suggesting a role for this mutation in the precocious puberty phenotype. (J Clin Endocrinol Metab 95: 2276-2280, 2010)

Maternal and neonatal interleukin-1 receptor antagonist genotype and pregnancy outcome in a population with a high rate of pre-term birth

Problem We evaluated associations between a length polymorphism in intron 2 of the gene coding for IL-1ra (gene symbol IL1RN) and pregnancy outcome in a population with a high rate of preterm birth. Method of study Subjects were pregnant women in Maceio, Brazil and their newborns. DNA was tested for IL1RN genotypes and alleles by gene amplification using primer pairs that spanned the polymorphic region. Every subject completed a detailed questionnaire. Results The frequency of allele 2 (IL1RN*2) carriage was elevated in mothers with a spontaneous preterm birth (SPTB) in the current pregnancy (P = 0.02) and also with a prior preterm delivery (P = .01). Both SPTB with intact membranes (P = 0.01) and SPTB preceded by pre-term pre-mature rupture of membranes (P = .03) were associated with IL1RN*2 carriage. A previous fetal demise was more than twice as prevalent in mothers positive for two copies of IL1RN*2. Conclusion Maternal carriage of IL1RN*2 increases susceptibility to inflammation-triggered spontaneous pre-term birth.

Analysis of the PTPN11 gene in idiopathic short stature children and Noonan syndrome patients

Background Mutations in the PTPN11 gene are the main cause of Noonan syndrome (NS). The presence of some NS features is a frequent finding in children with idiopathic short stature (ISS). These children can represent the milder end of the NS clinical spectrum and PTPN11 is a good candidate for involvement in the pathogenesis of ISS. Objective To evaluate the presence of mutations in PTPN11 in ISS children who presented NS-related signs and in well-characterized NS patients. Patients and methods We studied 50 ISS children who presented at least two NS-associated signs but did not fulfil the criteria for NS diagnosis. Forty-nine NS patients diagnosed by the criteria of van der Burgt et al. were used to assess the adequacy of these criteria to select patients for PTPN11 mutation screening. The coding region of PTPN11 was amplified by polymerase chain reaction (PCR), followed by direct sequencing. Results No mutations or polymorphisms were found in the coding region of the PTPN11 gene in ISS children. Nineteen of the 49 NS patients (39%) presented mutations in PTPN11. No single characteristic enabled us to distinguish between NS patients with or without PTPN11 mutations. Conclusion Considering that no mutations were found in the present cohort with NS-related signs, it is unlikely that mutations would be found in unselected ISS children. The van der Burgt et al. criteria are adequate in attaining NS diagnosis and selecting patients for molecular studies. Mutations in the PTPN11 gene are commonly involved in the pathogenesis of NS but are not a common cause of ISS.

Cognitive deficits, length of illness and symptom severity in schizophrenia

Background Research using neuropsychological testing has demonstrated that patients with schizophrenia show deficits in multiple neurocognitive domains. The aim of this study is to identify cognitive deficits that correlate with length of illness and symptom severity. Method Twenty clinically stable outpatients with chronic schizophrenia (18M : 2F) and 14 healthy controls (13M : 1F), matched on age, gender and parental education, were administered a neuropsychological battery consisting of the Hayling Sentence Completion Test (HSCT), WMS-III Verbal Paired Associates & Letter Number Sequencing, Modified Card Sort Test (MCST), Pyramids & Palm Trees Test, National Adult Reading Test (NART), Controlled Oral Word Association Test (COWAT), and WAIS-III. Severity of symptoms was rated with the Structured Clinical Interview – Positive and Negative Syndromes Scale (SCI-PANSS). Results In comparison to controls, patients showed significant deficits on all of the neuropsychological tasks except for the COWAT. MCST total categories, NART, Verbal IQ and arithmetic, similarities & digit symbol of the WAIS-III had the largest effect size between the groups. The longer the illness duration, the poorer the performance on WAISIII block design and the lower the performance IQ score. The poorer the performance on WMS-III letter number sequencing, the greater the positive symptoms, negative symptoms and general psychopathology. Conclusion Compared to controls, patients showed large effect sizes on measures of executive functioning, intelligence, working memory, verbal comprehension and speed of processing. The findings suggest that impairment in executive functioning and performance IQ is associated with length of illness, while impairment in working memory is associated with heightened symptom severity.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Pollymorphisms in the CBS Gene and Homocysteine, Folate and Vitamin B(12) Levels: Association With Polymorphisms in the MTHFR and MTRR Genes in Brazilian Children

Polymorphisms in the methylenetetrahydrofolate reductase (MTHFR), methionine synthase reductase (MTRR) and cystathionine P-synthase (CBS) genes, involved in the intracellular metabolism of homocysteine (Hcy), can result in hyperhomocysteinemia. The objective of this study was to evaluate prevalence estimates of CBS T833C, G919A and the insertion of 68-bp (844ins68) polymorphisms and their correlation with Hcy, folate and 131, in 220 children previously genotyped for MTHFR C677T, A1298C, and MTRR A66G. The prevalence of heterozygote children for 844ins68 was 19.5%. The T833C CBS mutation was identified in association with 844ins68 in all the carriers of the insertion. Genotyping for CBS G919A mutation showed that all the children presented the GG genotype. Analysis of Hcy, B(12) and folate, according to the combination of the different genotypes of the C677T and A1298C MTHFR, A66G MTRR, and 844ins68 CBS showed that the 677TT/1298AA/68WW genotype is associated with an increase in Hcy, when compared to the 677CC/1298AC/68WW (P = 0.033) and the 677CT/1298AA/68WW genotypes (P = 0.034). Since B(12) and folate were not different between these groups, a genetic interaction between diverse polymorphisms probably influences Hcy. Our results emphasize the role of genetic interactions in Hcy levels. (C) 2008 Wiley-Liss, Inc.

A novel method for development of species and strain-specific DNA probes and PCR primers for identifying Burkholderia solanacearum (formerly Pseudomonas solanacearum)

Six Burkholderia solanacearum (formerly Pseudomonas solanacearum) genomic DNA fragments were isolated, using RAPD techniques and cloning, from the three genetically diverse strains: ACH092 (Biovar 4), ACH0158 (Biovar 2) and ACH0171 (Biovar 3) (1). One of these cloned fragments was selected because it was present constantly in all bacterial strains analysed. The remaining five clones were selected because Southern hybridisation revealed that each showed partial or complete specificity towards the strain of origin. A seventh genomic fragment showing a strain-specific distribution in Southern hybridisations was obtained by differential restriction, hybridisation and cloning of genomic DNA. Each of these clones was sequenced and primers to amplify the insert were designed. When DNA from the strain of origin was used as template, PCR amplification for each of these fragments yielded a single band on gel analysis. One pair of primers amplified the species-constant fragment of 281 bp from DNA of all B. solanacearum strains investigated, from DNA of the closely related bacterium which causes ''blood disease'' of banana (BDB) and in P. syzigii. The sensitivity of detection of B. solanacearum using these ubiquitous primers was between 1.3 and 20 bacterial cells. The feasibility and reliability of a PCR approach to detection and identification of B. solanacearum was tested in diverse strains of the bacterium in several countries and laboratories.

Meta-analysis of the association of 4 angiotensinogen polymorphisms with essential hypertension - A role beyond M235T?

Angiotensinogen (AGT) gene polymorphisms have been linked to increased risk of hypertension, but the data remain controversial. In this study we review the most commonly investigated polymorphisms at the AGT locus (other than M235T) and provide summary estimates regarding their association with essential hypertension, while addressing heterogeneity, as well as publication biases. Data on 26 818 subjects from 46 studies for the 4 most-studied AGT variants (T174M in exon 2 and 3 promoter variants: A-6G, A-20C, and G-217A) were meta-analyzed. Statistically significant associations with hypertension were identified for the T174M ( odds ratio [OR]: 1.19; 95% CI: 1.07 to 1.33; P = 0.002) and G-217A (OR: 1.37; 95% CI: 1.17 to 1.59; P = 0.00006) polymorphisms. A dual but consistent effect was observed for the -20C allele, which was associated with a decreased risk of hypertension in populations of mixed and European ancestries (OR: 0.64; 95% CI: 0.44 to 0.92; P = 0.02 and OR: 0.77; 95% CI: 0.65 to 0.91; P = 0.003, respectively), but with a 24% increase in the odds of hypertension in Asian subjects (OR: 1.24; 95% CI: 1.04 to 1.48; P = 0.02). No association of the A-6G variant with hypertension was detected. Current studies support the notion that single variants at the AGT might modulate the risk of hypertension but indicate caution in interpreting these results because of the putative presence of publication bias and gene-environment interactions.

Association between ADAMTS13 polymorphisms and risk of cardiovascular events in chronic coronary disease

Introduction: Association between ADAMTS13 levels and cardiovascular events has been described recently. However, no genetic study of ADAMTS13 in coronary patients has been described. Materials and Methods: Based on related populations frequencies and functional studies, we tested three ADAMTS13 polymorphisms: C1342G (Q448E), C1852G (P618A) and C2699T (A900V) in a group of 560 patients enrolled in the Medical, Angioplasty, or Surgery Study II (MASS II), a randomized trial comparing treatments for patients with coronary artery disease (CAD) and preserved left ventricular function. The incidence of the 5-year end-points of death and death from cardiac causes, myocardial infarction, refractory angina requiring revascularization and cerebrovascular accident was determined for each polymorphim`s allele, genotype and haplotype. Risk was assessed with the use of logistic regression and Cox proportional-hazards model and multivariable adjustment was employed for possible confounders. Results: Clinical characteristics and received treatment of each genotype group were similar at baseline. In an adjusted model for cardiovascular risk variables, we were able to observe a significant association between ADAMTS13 900V variant and an increased risk of death (OR: 1,92 CI: 1,14-3,23, p = 0,015) or death from cardiac cause (OR: 2,67, CI: 1,59-4,49, p = 0,0009). No association between events and ADAMTS13 Q448E or P618A was observed. Conclusions: This first report studying the association between ADAMTS13 genotypes and cardiovascular events provides evidence for the association between ADAMTS13 900V variant and an increased risk of death in a population with multi-vessel CAD. (C) 2009 Elsevier Ltd. All rights reserved.

Association between glutathione S-transferase polymorphisms and triglycerides and HDL-cholesterol

Objective: Null genotypes of glutathione S-transferase (GSTs) exhibit absence of enzymatic activity and are hypothesized to modulate an increased risk of developing cardiovascular disease. The aim of this study was to identify the potential association between GSTM1 and GSTT1 deleted polymorphisms with cardiovascular risk factors and coronary atherosclerosis in two independent urban populations. Methods and results: Genotype distribution of GSTM1 and GSTT1 deleted polymorphism were examined in a sample of 1577 individuals from the general population and a replication sample of 871 individuals submitted to coronary angiography. Triglycerides, HDL-cholesterol and the triglycerides/HDL ratio were significantly associated with a double-deleted genotype in individuals from the general population. These findings were replicated in a second, independent, population of individuals submitted to coronary angiography. In addition, coronary artery disease severity was also associated with GSTs genotypes and the risk conferred from GSTs genotype was mainly due to triglycerides/HDL ratio information. Conclusions: The data suggest that the presence of a double deletion genotypes of the GSTM1 and GSTT1 genes is associated with hypertriglyceridemia and low HDL-cholesterol levels in humans. These novel findings may provide a new unexplored link between lipid metabolism and GST homeostasis. (C) 2009 Elsevier Ireland Ltd. All rights reserved.

European ancestry and polymorphisms in DNA repair genes modify the risk of melanoma: A case-control study in a high UV index region in Brazil

Background: UV radiation is the major environmental factor related to development of cutaneous melanoma. Besides sun exposure and the influence of latitude, some host characteristics such as skin phototype and hair and eye color are also risk factors for melanoma. Polymorphisms in DNA repair genes could be good candidates for susceptibility genes, mainly in geographical regions exposed to high solar radiation. Objective: Evaluate the role of host characteristic.; and DNA repair polymorphism in melanoma risk in Brazil. Methods: We carried out a hospital-based case-control study in Brazil to evaluate the contribution of host factors and polymorphisms in DNA repair to melanoma risk. A total of 412 patients (202 with melanoma and 210 controls) were analyzed regarding host characteristics for melanoma risk as well as for 11 polymorphisms in DNA repair genes. Results: We found an association of host characteristics with melanoma development, such as eye and hair color, fair skin, history of pigmented lesions removed, sunburns in childhood and adolescence, and also European ancestry. Regarding DNA repair gene polymorphisms, we found protection for the XPG 1104 His/His genotype (OR 0.32; 95% CI 0.13-0.75), and increased risk for three polymorphisms in the XPC gene (PAT+; IV-6A and 939Gln), which represent a haplotype for XPC. Melanoma risk was higher in individuals carrying the complete XPC haplotype than each individual polymorphism (OR 3.64; 95% CI 1.77-7.48). Conclusions: Our data indicate that the host factors European ancestry and XPC polymorphisms contributed to melanoma risk in a region exposed to high sun radiation. (C) 2011 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.

XPC polymorphisms play a role in tissue-specific carcinogenesis: a meta-analysis

XPC participates in the initial recognition of DNA damage during the DNA nucleotide excision repair process in global genomic repair. Polymorphisms in XPC gene have been analyzed in case-control studies to assess the cancer risk attributed to these variants, but results are conflicting. To clarify the impact of XPC polymorphisms in cancer risk, we performed a meta-analysis that included 33 published case-control studies. Polymorphisms analyzed were Lys939Gln and Ala499Val. The overall summary odds ratio (OR) for the associations of the 939Gln/Gln genotype with risk of cancer was 1.01 (95% confidence interval (95% CI): 0.94-1.09), but there were statistically significant associations for lung cancer, observed for the recessive genetic model (Lys/Lys + Lys/Gln vs Gln/Gln), (OR 1.30; 95% CI: 1.113-1.53), whereas for breast cancer a reduced but nonsignificant risk was observed for the same model (OR 0.87; 95% CI: 0.74-1.01). The results for Ala499Val showed a significant overall increase in cancer risk (OR 1.15; 95% CI: 1.02-1.31), and for bladder cancer in both the simple genetic model (Ala/Ala vs Val/Val) (OR 1.30; 95% CI: 1.04-1.61) and the recessive genetic model (Ala/Ala + Ala/Val vs Val/Val) (OR 1.32; 95% CI: 1.06-1.63). Our meta-analysis supports that polymorphisms in XPC may represent low-penetrance susceptibility gene variants for breast, bladder, head and neck, and lung cancer. XPC is a good candidate for large-scale epidemiological case-control studies that may lead to improvement in the management of highly prevalent cancers.