Metodologia de análise e diagnóstico de fratura em um componente automotivo sujeito a cargas cíclicas alternadas

The competitiveness of the trade generated by the higher availability of products with lower quality and cost promoted a new reality of industrial production with small clearances. Track deviations at the production are not discarded, uncertainties can statistically occur. The world consumer and the Brazilian one are supported by the consumer protection code, in lawsuits against the products poor quality. An automobile is composed of various systems and thousands of constituent parts, increasing the likelihood of failure. The dynamic and security systems are critical in relation to the consequences of possible failures. The investigation of the failure gives us the possibility of learning and contributing to various improvements. Our main purpose in this work is to develop a systematic, specific methodology by investigating the root cause of the flaw occurred on an axle end of the front suspension of an automobile, and to perform comparative data analyses between the fractured part and the project information. Our research was based on a flaw generated in an automotive suspension system involved in a mechanical judicial cause, resulting in property and personal damages. In the investigations concerning the analysis of mechanical flaws, knowledge on materials engineering plays a crucial role in the process, since it enables applying techniques for characterizing materials, relating the technical attributes required from a respective part with its structure of manufacturing material, thus providing a greater scientific contribution to the work. The specific methodology developed follows its own flowchart. In the early phase, the data in the records and information on the involved ones were collected. The following laboratory analyses were performed: macrography of the fracture, micrography with SEM (Scanning Electron Microscope) of the initial and final fracture, phase analysis with optical microscopy, Brinell hardness and Vickers microhardness analyses, quantitative and qualitative chemical analysis, by using X-ray fluorescence and optical spectroscopy for carbon analysis, qualitative study on the state of tension was done. Field data were also collected. In the analyses data of the values resulting from the fractured stock parts and the design values were compared. After the investigation, one concluded that: the developed methodology systematized the investigation and enabled crossing data, thus minimizing diagnostic error probability, the morphology of the fracture indicates failure by the fatigue mechanism in a geometrically propitious location, a tension hub, the part was subjected to low tensions by the sectional area of the final fracture, the manufacturing material of the fractured part has low ductility, the component fractured in an earlier moment than the one recommended by the manufacturer, the percentages of C, Si, Mn and Cr of the fractured part present values which differ from the design ones, the hardness value of the superior limit of the fractured part is higher than that of the design, and there is no manufacturing uniformity between stock and fractured part. The work will contribute to optimizing the guidance of the actions in a mechanical engineering judicial expertise

Metodologia, Sistema de Codificação e Ferramenta de software para Modelagem de Móveis Modulados

On this research we investigated how new technologies can help the process of design and manufacturing of furniture in such small manufacturers in Rio Grande do Norte state. Google SketchUp, a 3D software tool, was developed in such a way that its internal structures are opened and can be accessed using SketchUp s API for Ruby and programs written in Ruby language (plugins). Using the concepts of the so-called Group Technology and the flexibility that enables adding new functionalities to this software, it was created a Methodology for Modeling of Furniture, a Coding System and a plugin for Google s tool in order to implement the Methodology developed. As resulted, the following facilities are available: the user may create and reuse the library s models over-and-over; reports of the materials manufacturing process costs are provided and, finally, detailed drawings, getting a better integration between the furniture design and manufacturing process

Validação de uma metodologia de ensaio de resistência ao cisalhamento para avaliação da aderência de interfaces revestimento metálico-bainha de cimento aplicada a poços de petróleo

Improving the adherence between oilwell metallic casing and cement sheath potentially decrease the number of corrective actions present/y necessary for Northeastern wells submitted to steam injection. In addition to the direct costs involved in the corrective operations, the economic impact of the failure of the primary cementing aIso includes the loss in the production of the well. The adherence between casing and cement is current/y evaluated by a simple shear tests non standardized by the American Petroleum Institute (API). Therefore, the objective of the present is to propose and evaluate a standardized method to assess the adherence of oilwell metallic casing to cement sheath. To that end, a section of a cemented oilwell was simulated and used to test the effect of different parameters on the shear stress of the system. Surface roughness and different cement compositions submitted or not to thermal cycling were evaluated. The results revealed that the test geometry and parameters proposed yielded different values for the shear stress of the system, corresponding to different adherent conditions between metallic casing and cement sheath

Remoção de hidrocarbonetos do gás natural visando o ajuste do índice de metano

The use of the natural gas is growing year after year in the whole world and also in Brazil. It is verified that in the last five years the profile of natural gas consumption reached a great advance and investments had been carried through in this area. In the oil industry, the use of the natural gas for fuel in the drive of engines is usual for a long date. It is also used to put into motion equipment, or still, to generate electric power. Such engines are based on the motor cycle of combustion Otto, who requires a natural gas with well definite specification, conferring characteristic anti-detonating necessary to the equipment performance for projects based on this cycle. In this work, process routes and thermodynamic conditions had been selected and evaluated. Based on simulation assays carried out in commercial simulators the content of the methane index of the effluent gas were evaluated at various ranges of pressure, temperature, flowrate, molecular weight and chemical nature and composition of the absorbent. As final result, it was established a route based on process efficiency, optimized consumption of energy and absorbent. Thereby, it serves as base for the compact equipment conception to be used in locu into the industry for the removal of hydrocarbon from the natural gas produced

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Comparação da precisão dos resultados do teste de tetrazolio usando a metodologia alternativa e a tradicional em sementes de soja

The use of tetrazolium testing is recognized in the soybean seed quality control due to the large amount of data which it provides. Although it is considered a quick test, in 1998 an alternative methodology was proposed for the seed preconditioning, which allows 10 hours of time saving in seeds preparation. The objective of this research is to compare the accuracy of the new and the traditional tetrazolium testing. Three soybean seed genotypes were used, Conquista, Garantia and M-soy 8400, all 2000/2001 crop. The seeds were evaluated in relation to germination, evaluated with the traditional (TZt) and the alternative (Tza) tetrazolium test as well as with the accelerated aging performed in two different conditions (45 degrees C 24h(-1) and 45 degrees C 72h(-1)). After aging, the seeds too were submitted to TZt and Tza testing. The experimental design was a randomized blocks, with four replicates the 50 seeds per genotype in every evaluation, with exception only for tetrazolium test, with two replicates. The averages were compared in the Tukey test level of 5% probability. The comparison between the two methodologies in relation to level of vigor (class 1 to 3) and germination potential (class 1 to 5) indicated no statistical discrepancies, for aged non-aged seeds. This, the use of the alternative tetrazolium test is recommend in case a reduced seed preparation time is needed.

Influência do teor e granulometria da calcita e da temperatura de sinterização no desenvolvimento de massas cerâmicas para revestimento poroso(BIII)

This work aims at studying the influence of the concentration of calcite, its grain size and sintering temperature to obtain porous coating formulations that meet the design specifications. The experiments involved the physical-chemical and mineralogical caracterization of the raw materials, and mechanical tests on specimens dried and sintered, performing a planning mixture and factorial experiment, using the response surface methodology. The ceramic bodies studied were prepared by dry process, characterized, placed in conformity by uniaxial pressing and sintered at temperatures of 940 º C, 1000ºC, 1060ºC, 1120°C and 1180°C using a fast-firing cycle. The crystalline phases formed during sintering at temperatures under study, revealed the presence of anorthite and wolastonite, and quartz-phase remaining. These phases were mainly responsible for the physical and mechanical properties of the sintered especimens. The results shown that as increases the participation of carbonate in the composition of ceramic bodies there is an increase of water absorption and a slight reduction in linear shrinkage for all sintering temperatures. As for the mechanical strength it was observed that it tended to decrease for sintering at temperatures between 940 ° C and 1060 ° C and to increase for sintering at temperatures above 1060 ° C occurring with greater intensity for compositions with higher content of calcite. The resistence decreased with increasing participation of quartz in all sintering temperatures. The decrease in grain size of calcite caused a slight increase in water absorption for formulation with the same concentration of carbonate, remaining virtually unchanged the results of linear shrinkage and mechanical strength. In conclusion, porous ceramic coating (BIII) can be obtained using high concentrations of calcite and keeping the properties required in technical standards and that the particle size of calcite can be used as tuning parameter for the properties of ceramic products.

Aplicação e análise de metodologia de deterioração ambiental em micro-bacia do seridó potiguar

In the contemporary world to the deterioration of semi-arid areas of the planet has been the focus of media attention and the scientific community. Brazil has a semiarid, considered the most problematic of the world, either by pressure from physical factors, whether as a result of misguided public policies, has over time been suffering from the consequences of a deterioration that expands over the years. Methodologies, that amidst the problems of semi-arid, come against the deteriorating local, have a good chance to be reapplied in other contexts around the world. This research, based on methodological model for analyzing environmental deterioration, introduced and examined the applicability of the methodology in the semi-arid region of Rio Grande do Norte - Brazil. Although the results provide guidelines for the introduction of underground dams, the application of the methodology was ineffective, given the high rates of forest cover that gave low values for the physical diagnosis conservationist

Reúso de água no processamento de jeans na indústria têxtil

This study aims to assess the potential for industrial reuse of textile wastewater, after passing through a physical and chemical pretreatment, into denim washing wet processing operations in an industrial textile laundry, with no need for complementary treatments and dilutions. The methodology and evaluation of the proposed tests were based on the production techniques used in the company and upgraded for the experiments tested. The characterization of the treated effluent for 16 selected parameters and the development of a monitoring able to tailor the treated effluent for final disposal in accordance with current legislation was essential for the initiation of testing for reuse. The parameters color, turbidity, SS and pH used were satisfactory as control variables and presents simple determination methods. The denim quality variables considered were: color, odor, appearance and soft handle. The tests were started on a pilot scale following complexity factors attributed to the processes, in denim fabric and jeans, which demonstrated the possibility of reuse, because there was no interference in the processes and at quality of the tested product. Industrial scale tests were initiated by a step control that confirmed the methodology efficiency applied to identify the possibility of reuse by tests that precede each recipe to be processed. 556 replicates were performed in production scale for 47 different recipes of denim washing. The percentage of water reuse was 100% for all processes and repetitions performed after the initial adjustment testing phase. All the jeans were framed with the highest quality for internal control and marketed, being accepted by contractors. The full-scale use of treated wastewater, supported by monitoring and evaluation and control methodology suggested in this study, proved to be valid in textile production, not given any negative impact to the quality the produced jeans under the presented conditions. It is believed that this methodology can be extrapolated to other laundries to determine the possibility of reuse in denim washing wet processing with the necessary modifications to each company.

Caracterização e avaliação do macro sistema urbano de distribuição de água de Natal RN

The aim of this study is to characterize and evaluate the Macro System of Regional Water Distribution Natal North (RNN) and Southern Regional Natal (RNS), covering 35% and 65% respectively of the Natal-RN City. The terms of the quality and quantity of water (surface and groundwater) were also evaluated in order to adjust the parameters that contribute to proper distribution and control in water reserves. The methodology of the work took place from collecting volumetric data of production capacity and distribution of the two treatment plants for Regional as well as the flow rates of wells. Yet the quantitative capacity of reservation, distribution and consumption of the main reservoirs, population numbers and consumption of members neighborhoods were collected. Data were tabulated and used in computational simulator EPANET to diagnose possible through the water balance, the offers and demands on the water supply system in the neighborhoods of the capital, linking them to specific distribution points. We also evaluated the wells in the levels of nitrate in water consumed. As a result it was found that some neighborhoods in the South Regional Natal, was ranked as critical supply situation: City of Hope, Lagoa Nova and Nova Descoberta, where demand exceeds supply. While in most Northern Regional Natal present deficiency in the supply system as: Lagoa Azul, the Parque dos Coqueiros, igapó, Amarante and Salinas. The rates of nitrate in the city were significant, but manageable with corrective and preventive measures. The averages were 12 mg /l-N in Candelária, 10 mg/l-N in Lagoa Nova, 9 mg/l-N in Satelite, 20 mg/l-N in Gramore and 15 mg/l-N in N. Sra. Apresentação. Therefore proper distribution of water abstracted and implementation of quality control ensures the supply required by the system, associated with preservation of Water Resources of the Metropolitan Region of Natal

Multicamadas Ferromagnéticas Nanométricas Periódicas e Quasiperiódicas

We present a study of nanostructured magnetic multilayer systems in order to syn- thesize and analyze the properties of periodic and quasiperiodic structures. This work evolved from the deployment and improvement of the sputtering technique in our labora- tories, through development of a methodology to synthesize single crystal ultrathin Fe (100) films, to the final goal of growing periodic and quasiperiodic Fe/Cr multilayers and investi- gating bilinear and biquadratic exchange coupling between ferromagnetic layer dependence for each generation. Initially we systematically studied the related effects between deposition parameters and the magnetic properties of ultrathin Fe films, grown by DC magnetron sput- tering on MgO(100) substrates. We modified deposition temperature and film thickness, in order to improve production and reproduction of nanostructured monocrystalline Fe films. For this set of samples we measured MOKE, FMR, AFM and XPS, with the aim of investi- gating their magnocrystalline and structural properties. From the magnetic viewpoint, the MOKE and FMR results showed an increase in magnetocrystalline anisotropy due to in- creased temperature. AFM measurements provided information about thickness and surface roughness, whereas XPS results were used to analyze film purity. The best set of parame- ters was used in the next stage: investigation of the structural effect on magnetic multilayer properties. In this stage multilayers composed of interspersed Fe and Cr films are deposited, following the Fibonacci periodic and quasiperiodic growth sequence on MgO (100) substrates. The behavior of MOKE and FMR curves exhibit bilinear and biquadratic exchange coupling between the ferromagnetic layers. By computationally adjusting magnetization curves, it was possible to determine the nature and intensity of the interaction between adjacent Fe layers. After finding the global minimum of magnetic energy, we used the equilibrium an- gles to obtain magnetization and magnetoresistance curves. The results observed over the course of this study demonstrate the efficiency and versatility of the sputtering technique in the synthesis of ultrathin films and high-quality multilayers. This allows the deposition of magnetic nanostructures with well-defined magnetization and magnetoresistance parameters and possible technological applications

Estratégias para ajuste do ciclo vigília-sono de adolescentes aos horários escolares matutinos: a educação sobre o sono e a exposição a luz solar

In adolescents, who tend to sleep and wake-up later, the school schedule in the morning is associated with sleep advancement and shortening besides bedtime and wake-up time irregularity between week and weekend days. As a result, there is an increase in daytime sleepiness and a drop in cognitive performance that interfer in students performance in classroom. These consequences reinforce the need to evaluate alternatives that help the adolescent to adapt their sleep needs to the time of start of classes in the morning. Accordingly, the general aim of this study was to evaluate the effects of a sleep program education and sunlight exposure in early morning on sleep-wake cycle (SWC) and daytime sleepiness of adolescents. The students chronotype were evaluated by the Horne-Ostberg questionnaire and the health and usual sleep habits by "the health and the sleep questionnaire. The SWC patterns were assessed by sleep log, the daytime sleepiness by Karolinska Sleepiness Scale (KSS) and the alertness by the Psychomotor Vigilance Test (PVT). These parameters were compared before and after a sleep education program and before and during the sunlight exposure. The sleep program was effective in increasing sleep knowledge of adolescents, in promoting a reduction of bedtime and wake-up time irregularity and increasing the sleep duration in school days. The sunlight exposure effect was evaluated in the return to classes after vacation due to the difference in sleep patterns between school and vacation days. During the intervention week it was observed an advance of sleep schedules, an increase on sleep duration and alertness at the end of the morning. Assessed separately, sleep education and sunlight exposure should contribute to minimize adolescents partial sleep deprivation, but daytime sleepiness effect must be better investigated. These strategies should be used jointly by school members to improve health and performance of their students

Metodologia para rastreamento com modificação dos zeros e rejeição de distúrbio aplicada a sistemas incertos

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Desenvolvimento de uma metodologia para caracterização de amostras de sedimento: Rio Jundiaí RN

The study of sediment in water bodies presents great environmental importance, because of its ability to adsorb the pollutants, they may facilitate the understanding of the history of the current quality of the water system. Depending on how it is done the collection, analysis can show both a recent contamination as old. The detailed characterization of the sediment may reveal details that can understand how each type of pollutant interacts with the material given its composition. In this work it has developed a systematic methodology to characterize samples of sediment, with the aim to understand how a series of metal is distributed in different size fractions of the sediment. This study was conducted in five samples of sediment (P1, P2, P3a, P3B and P3c) collected in Jundiaí river, one of the most important tributaries of the river Potengi in the region of Macaíba, RN. The characterization was made with the samples previously sieved into meshes with different granulometries (+8#, -8+16#, -16+65# - 65+100#,-100+200#,-200+250# and -250#), using the following techniques: Analysis of specific surface area by BET method, determining the levels of organic matter (OM%) and humidity through the gravimetry and Analysis Thermogravimetric (TG), Infrared Spectroscopy in a Fourier transform (FTIR ), Analysis of X ray diffraction (XRD), analysis of heavy metals by optical emission spectrometry with the Argon Plasma (ICP-OES). The analyzed elements were Al, Cd, Cr, Cu, Fe, Mn, Ni, Zn and P. In addition to the techniques of characterization above, was also made the rebuilding of the samples P1, P2 and P3B in relation to the levels of organic matter and concentration of heavy metals. Then, the results of the recomposed samples were compared with those obtained in crude samples, showing great consistency. The gravimetry, used in determining the levels of organic matter, was not considered an appropriate method because the clay minerals present in the sediment samples analyzed fall apart in the same range of temperature (550-600 0C) used in roasting (600 0C). The results also showed the trend of organic matter and heavy metals to focus on the thin fractions, although the largest concentrations of metals are in intermediate fractions

Considerações sobre metodologia interativa aplicada à disciplinas de química orgânica de alguns cursos da UFRN

The aiming of this work is linked to chemical education, focusing organic chemistry classes of Chemical Engineering, Pharmacy and Zootechny graduate courses of the Federal University of Rio Grande do Norte. For that, teaching-learning process related to basic chemical subjects which support the understanding of organic chemistry concepts was evaluated in a research period of two years. The education proposal linked to the theoretical content of the cited classes, pointed out the process of knowledge construction, in which educational commitment as well as dedication in the teaching-learning process was also valued. In that approach several didactic tools were applied, among them scientific articles were used as supplementary studies of the basic organic chemistry concepts and related. The acceptability of students, as well as their motivation, performance and learning process was justified by the data collection of the applied teaching methodology. The acceptability and commitment of the students facing this teaching interactive approach, which transversely contributed to the intellectual maturity growth of the students, as well their professional development, were evidenced by satisfactory obtained results that will be herein discussed