Characterization of 1:12 Phosphomolybdic Anions Doped Polypyrrole (PMo12/PPy) Film Electrode

1:12 phosphomolybdic anion doped polypyrrole film electrode was characterized by in-situ UV-vis spectroelectrochemistry, X-ray photoelectron spectroscopy(XPS), scan electronic microscopy(SEM) and electron spin resonance(ESR) spectroscopy.

Synthesis of NiWO4 nano-particles in low-temperature molten salt medium

Nickel tungstate (NiWO4) nano-particles were successfully synthesized at low temperatures by a molten salt method, and characterized by Xray diffraction (XRD), transmission electron microscopy (TEM) and ultraviolet visible spectra techniques (UV-vis), respectively. The effects of calcining temperature and salt quantity on the crystallization and development of NiWO4 crystallites were studied. Experimental results showed that the well-crystallized NiWO4 nano-particles with about 30 nm in diameter could be prepared at 270 degrees C with 6:1 mass ratio of the salt to NiWO4 precursor. XRD analysis confirmed that the product was a pure monoclinic phase of NiWO4 with wolframite structure. UV-vis spectrum revealed that NiWO4 nano-particles had good light absorption properties in both ultraviolet and visible light region. (C) 2009 Elsevier Ltd and Techna Group S.r.l. All rights reserved.

Direct synthesis and characterization of titanium-substituted mesoporous molecular sieve SBA-15

Ti-substituted mesoporous SBA-15 (Ti-SBA-15) materials have been synthesized by using a new approach in which the hydrolysis of the silicon precursor (tetramethoxysilane, TMOS) is accelerated by fluoride. These materials were characterized by powder X-ray diffraction patterns (XRD), X-ray fluorescence spectroscopy (Y-RF), N-2 sorption isotherms, diffuse-reflectance UV-visible (UV-vis) and UV-Raman spectroscopy, Si-29 MAS NMR, and the catalytic epoxidation reaction of styrene. Experiments show that Ti-SBA-15 samples of high quality can be obtained under the following conditions: F/Si greater than or equal to 0.03 (molar ratio), pH less than or equal to 1.0, aging temperature less than or equal to 80 degreesC, and Ti/Si less than or equal to 0.01. It was found that the hydrolysis rate of TMOS was remarkably accelerated by fluoride, which was suggested to play the main role in the formation of Ti-SBA-15 materials of high quality. There is no stoichiometric incorporation of Ti, and the Ti contents that are obtained are quite low in the case of the approach that is proposed. The calcined Ti-SBA-15 materials show highly catalytic activity in the epoxidation of styrene.

Pump-dump control and the related transient absorption spectroscopies

We combine theories of optimal pump-dump control and the related transient probe absorption spectroscopy in order to elucidate the relation between these two optical processes and the possibility of experimental realization. In the weak response regime, we identify the globally optimal pair of pump-dump control fields, and further propose a second-order difference detection scheme to monitor the wave packets dynamics that is jointly controlled by both the pump and dump fields. The globally optimal solution serves also as the initial input for the iterative search for the optimal control fields in the strong response regime. We use a model I-2 molecule to demonstrate numerically the pump-dump control and the detection of a highly vibrationally excited wave packet focusing dynamics on the ground X surface in both the weak and strong response regimes. The I2B surface serves as the intermediate to assist the pump-dump control and the optical detection processes. Demonstrated in the strong response regime are the optimal pair of pump-dump molecular-pi pulses that invert nearly total population onto the predefined target region within a half period of vibration motion. (C) 1999 American Institute of Physics. [S0021-9606(99)00115-4].

Direct synthesis of highly ordered Fe-SBA-15 mesoporous materials under weak acidic conditions

Iron-substituted SBA-15 (Fe-SBA-15) materials have been synthesized via a simple direct hydrothermal method under weak acidic conditions. The powder X-ray diffraction (XRD), NZ sorption and transmission electron microscopy (TEM) characterizations show that the resultant materials have well-ordered hexagonal meso-structures. The diffused reflectance UV-vis and UV resonance Raman spectroscopy characterizations show that most of the iron ions exist as isolated framework species for calcined materials when the Fe/Si molar ratios are below 0.01 in the gel. The presence of iron species also has significant salt effects that can greatly improve the ordering of the mesoporous structure. Different iron species including isolated framework iron species, extraframework iron clusters and iron oxides are formed selectively by adjusting the pH values of the synthesis solutions and Fe/Si molar ratios. (c) 2005 Elsevier Inc. All rights reserved.

Post-grafting preparation of large-pore mesoporous materials with localized high content titanium doping

A new post-grafting process, consisting of two steps of substrate preparation and sol - gel post-grafting, has been developed to prepare titanium-doped mesoporous SBA-15 material with a double-layered structure and locally concentrated titanium content at the inner pore surface. With this novel technique, the single phased and originally ordered mesostructures can be well conserved; in the conventional direct synthesis they can be partially damaged when the frameworks are doped with high content heteroatoms. Titanium species exist in an isolated, tetrahedral structure and are localized at the pore surface; this is beneficial to both reactant access and product release. Characterization with XRD, N-2 adsorption/desorption isotherms, HREM/ EDS, ICP, UV - Vis, and the newly developed UV - Raman spectroscopy confirm these results. Preliminary catalytic tests with the selective epoxidation of cyclohexene show good catalytic activity. Among them, sample TiSBA-15-10 with a Si : Ti molar ratio of 10 shows a TON value of 75 and a highest product ( epoxide) yield of 55%.

Determination of the optical band-gap energy of cubic and hexagonal boron nitride using luminescence excitation spectroscopy

Sponsorship: EPSRC, STFC

Kinetic Analysis of Ester Hydrolysis

A two-week multi-step experiment that introduces students to mechanistic organic chemistry and substituent effects. A simple preparation of differentially substituted para-nitrophenyl benzoates is followed by ester hydrolysis with monitoring by UV-Vis spectroscopy to provide rate data for the reaction.

Synthesis and characterization of oxide materials

Nanostructured materials are central to the evolution of future electronics and biomedical applications amongst other applications. This thesis is focused on developing novel methods to prepare a number of nanostructured metal oxide particles and films by a number of different routes. Part of the aim was to see how techniques used in nanoparticle science could be applied to thin film methods to develop functional surfaces. Wet-chemical methods were employed to synthesize and modify the metal oxide nanostructures (CeO2 and SiO2) and their structural properties were characterized through advanced X-ray diffraction, electron microscopy, photoelectron spectroscopy and other techniques. Whilst particulates have uses in many applications, their attachment to surfaces is of importance and this is frequently challenging. We examined the use of block copolymer methods to form very well defined metal oxide particulate-like structures on the surface of a number of substrates. Chapter 2 describes a robust method to synthesize various sized silica nanoparticles. As-synthesized silica nanoparticles were further functionalized with IR-820 and FITC dyes. The ability to create size controlled nanoparticles with associated (optical) functionality may have significant importance in bio-medical imaging. Thesis further describes how non-organic modified fluorescent particles might be prepared using inorganic oxides. A study of the concentrations and distributions of europium dopants within the CeO2 nanoparticles was undertaken and investigated by different microscopic and spectroscopic techniques. The luminescent properties were enhanced by doping and detailed explanations are reported. Additionally, the morphological and structural evolution and optical properties were correlated as a function of concentrations of europium doping as well as with further annealing. Further work using positron annihilation spectroscopy allowed the study of vacancy type defects formed due to europium doping in CeO2 crystallites and this was supported by complimentary UV-Vis spectra and XRD work. During the last few years the interest in mesoporous silica materials has increased due to their typical characteristics such as potential ultra-low dielectric constant materials, large surface area and pore volume, well-ordered and uniform pores with adjustable pores between 2 and 50 nm. A simple, generic and cost-effective route was used to demonstrate the synthesis of 2D mesoporous silica thin films over wafer scale dimensions in chapter 5. Lithographic resist and in situ hard mask block copolymer followed by ICP dry etching were used to fabricate mesoporous silica nanostructures. The width of mesoporous silica channels can be varied by using a variety of commercially available lithographic resists whereas depth of the mesoporous silica channels can be varied by altering the etch time. The crystal structure, morphology, pore arrangement, pore diameters, thickness of films and channels were determined by XRD, SEM, ellipsometry and the results reported. This project also extended work towards the study of the antimicrobial study of nanopatterned silver nanodot arrays formed using the block copolymer approach defined above. Silver nanodot arrays were successfully tested for antimicrobial activity over S. aureus and P. aeruginosa biofilms and results shows silver nanodots has good antimicrobial activity for both S. aureus and P. aeruginosa biofilms. Thus, these silver nanodot arrays shows a potential to be used as a substitute for the resolution of infection complications in many areas.

De novo design and molecular assembly of a transmembrane diporphyrin-binding protein complex.

The de novo design of membrane proteins remains difficult despite recent advances in understanding the factors that drive membrane protein folding and association. We have designed a membrane protein PRIME (PoRphyrins In MEmbrane) that positions two non-natural iron diphenylporphyrins (Fe(III)DPP's) sufficiently close to provide a multicentered pathway for transmembrane electron transfer. Computational methods previously used for the design of multiporphyrin water-soluble helical proteins were extended to this membrane target. Four helices were arranged in a D(2)-symmetrical bundle to bind two Fe(II/III) diphenylporphyrins in a bis-His geometry further stabilized by second-shell hydrogen bonds. UV-vis absorbance, CD spectroscopy, analytical ultracentrifugation, redox potentiometry, and EPR demonstrate that PRIME binds the cofactor with high affinity and specificity in the expected geometry.

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

Surface alloying and mixing at the Mn/Fe(001) interface: Real-time photoelectron spectroscopy and modified embedded atom simulations

Structural and magnetic properties of thin Mn films on the Fe(001) surface have been investigated by a combination of photoelectron spectroscopy and computer simulation in the temperature range 300 Kless than or equal toTless than or equal to750 K. Room-temperature as deposited Mn overlayers are found to be ferromagnetic up to 2.5-monolayer (ML) coverage, with a magnetic moment parallel to that of the iron substrate. The Mn atomic moment decreases with increasing coverage, and thicker samples (4-ML and 4.5-ML coverage) are antiferromagnetic. Photoemission measurements performed while the system temperature is rising at constant rate (dT/dtsimilar to0.5 K/s) detect the first signs of Mn-Fe interdiffusion at T=450 K, and reveal a broad temperature range (610 Kless than or equal toTless than or equal to680 K) in which the interface appears to be stable. Interdiffusion resumes at Tgreater than or equal to680 K. Molecular dynamics and Monte Carlo simulations allow us to attribute the stability plateau at 610 Kless than or equal toTless than or equal to680 K to the formation of a single-layer MnFe surface alloy with a 2x2 unit cell and a checkerboard distribution of Mn and Fe atoms. X-ray-absorption spectroscopy and analysis of the dichroic signal show that the alloy has a ferromagnetic spin structure, collinear with that of the substrate. The magnetic moments of Mn and Fe atoms in the alloy are estimated to be 0.8mu(B) and 1.1mu(B), respectively.

Absolute Absorption Cross-Section Measurement of a Submonolayer film on a silica microresonator

Conventional absorption spectroscopy is not nearly sensitive enough for quantitative overtone measurements on submonolayer coatings. While cavity-enhanced absorption detection methods using microresonators have the potential to provide quantitative absorption cross sections of even weakly absorbing submonolayer films, this potential has not yet been fully realized. To determine the absorption cross section of a submonolayer film of ethylene diamine (EDA) on a silica microsphere resonator, we use phase-shift cavity ringdown spectroscopy simultaneously on near-IR radiation that is Rayleigh backscattered from the microsphere and transmitted through the coupling fiber taper. We then independently determine both the coupling coefficient and the optical loss within the resonator. Together with a coincident measurement of the wavelength frequency shift, an absolute overtone absorption cross section of adsorbed EDA, at submonolayer coverage, was obtained and was compared to the bulk value. The smallest quantifiable absorption cross section is σmin 2.7 × 10−12 cm2. This absorption cross section is comparable to the extinction coefficients of, e.g., single gold nanoparticles or aerosol particles. We therefore propose that the present method is also a viable route to absolute extinction measurements of single particles.

A review of the effect of the addition of hydrogen in the selective catalytic reduction of NOx with hydrocarbons on silver catalysts

Research is progressing fast in the field of the hydrogen assisted hydrocarbon selective catalytic reduction (HC-SCR) over Ag-based catalysts: this paper is a review of the work to date in this area. The addition of hydrogen to the HC-SCR reaction feed over Ag/Al2O3 results in a remarkable improvement in NO (x) conversion using a variety of different hydrocarbon feeds. There is some debate concerning the role that hydrogen has to play in the reaction mechanism and its effect on the form of Ag present during the reaction. Many of the studies use in situ UV-Vis spectroscopy to monitor the form of Ag in the catalyst and appear to indicate that the addition of hydrogen promotes the formation of small Ag clusters which are highly reactive for NO (x) conversion. However, some authors have expressed concern about the use of this technique for these materials and further work is required to address these issues before this technique can be used to give an accurate assessment of the state of Ag during the SCR reaction. A study using in situ EXAFS to probe the H-2 assisted octane-SCR reaction has shown that small Ag particles (containing on average 3 silver atoms) are formed during the SCR reaction but that the addition of H-2 to the feed does not result in any further change in the Ag particle size. This points to the direct involvement of H-2 in the reaction mechanism. Clearly the addition of hydrogen results in a large increase in the number and variety of adsorbed species on the surface of the catalyst during the reaction. Some authors have suggested that conversion of cyanide to isocyanate is the rate-determining step and that hydrogen promotes this conversion. Others have suggested that hydrogen reduces nitrates to more reactive nitrite species which can then activate the hydrocarbon; activation of the hydrocarbon to form acetates has been proposed as the key step. It is probable that all these promotional effects can take place and that it very much depends on the reaction temperature and feed conditions as to which one is most important.

Purification of imidazolium ionic liquids for spectroscopic applications

Ionic liquids are often contaminated by colored impurities. These impurities can be problematic for spectroscopic studies or for monitoring organic reactions by UV/Vis spectroscopy. The effect of different purification methods on the optical quality of colored ionic liquids was studied and compared. Yellowish ionic liquids can partially be decolorized by treatment with active charcoal or by recrystallization. Our experiments show column liquid chromatography is not always a good technique to prepare spectrograde imidazolium halide ionic liquids. Colorless and UV-transparent ionic liquids were synthesized by a method that can exclude the need for further purification steps. (c) 2005 Elsevier B.V. All rights reserved.