The chemistry of intrinsically chiral surfaces

Intrinsically chiral metal and mineral surfaces show enantioselective behaviour without modifiers. Examples are artificial high-Miller-index surfaces of metal single crystals with cubic bulk lattice symmetry, which have no mirror planes and are therefore chiral, or surfaces of naturally occurring crystallites of some common minerals, such as alpha-quartz or calcite. Recent findings with regards to the surface geometry, reactivity and thermal stability of intrinsically chiral surfaces are discussed. A number of enantioselective effects have been reported in connection with the adsorption of small chiral molecules (e.g. alanine, cysteine) on intrinsically chiral surfaces under well-defined conditions. From a combination of experimental surface science techniques and theoretical ab initio model calculations it emerges that these effects are due to a combination of attractive and repulsive adsorbate-substrate and inter-adsorbate interactions.

Gas-solid reactions of single crystals: a study of reactions of NH3 and NO2 with single crystalline organic substrates by infrared microspectroscopy

Reaction of single crystals of benzoic and trans-cinnamic acids with 200 Torr pressure of ammonia gas in a sealed glass bulb at 20 degrees C generates the corresponding ammonium salts; there is no sign of any 1:2 adduct as has been reported previously for related systems. Isotopic substitution using ND3 has been used to aid identification of the products. Adipic acid likewise reacts with NH3 gas to form a product in which ammonium salts are formed at both carboxylic acid groups. Reaction of 0.5 Torr pressure of NO2 gas with single crystals of 9-methylanthracene and 9-anthracenemethanol in a flow system generates nitrated products where the nitro group appears to be attached at the 10-position, i.e. the position trans to the methyl or methoxy substituent on the central ring. Isotopic substitution using (NO2)-N-15 has been used to confirm the identity of the bands arising from the coordinated NO2 group. The products formed when single crystals of hydantoin are reacted with NO2 gas under similar conditions depend on the temperature of the reaction. At 20 degrees C, a nitrated product is formed, but at 65 degrees C this gives way to a product containing no nitro groups. The findings show the general applicability of infrared microspectroscopy to a study of gas-solid reactions of organic single crystals. (c) 2005 Elsevier B.V. All rights reserved.

Gas-solid reactions of single crystals: a study of the reaction of bromine with single crystals of trans-cinnamic acid and a range of its derivatives by infrared and Raman microspectroscopy

Single crystals of trans-cinnamic acid and of a range of derivatives of this compound containing halogen substituents on the aromatic ring have been reacted with 165 Torr pressure of bromine vapour in a sealed desiccator at 20 degrees C for 1 week. Infrared and Raman microspectroscopic examination of the crystals shows that bromination of the aliphatic double bond, but not of the aromatic ring, has occurred. It is demonstrated also that the reaction is truly gas-solid in nature. A time-dependent study of these reactions shows that they do not follow a smooth diffusion-controlled pathway. Rather the reactions appear to be inhomogeneous and to occur at defects within the crystal. The reaction products are seen to flake from the surface of the crystal. It is shown, therefore, that these are not single crystal to single crystal transitions, as have been observed previously for the photodimerisation of trans-cinnamic acid and several of its derivatives. It is shown that there are no by-products of the reaction and that finely ground samples react to form the same products as single crystals.

Quartz crystal microbalance monitoring of density changes in mesoporous TiO2 phytate films during redox and ion exchange processes

Nanofilm deposits of TiO2 nanoparticle phytates are formed on gold electrode surfaces by 'directed assembly' methods. Alternate exposure of a 3-mercapto-propionic acid modified gold surface to (i) a TiO2 sol and (ii) an aqueous phytic acid solution (pH 3) results in layer-by-layer formation of a mesoporous film. Ru(NH3)(6)(3+) is shown to strongly adsorb/accumulate into the mesoporous structure whilst remaining electrochemically active. Scanning the electrode potential into a sufficiently negative potential range allows the Ru(NH3)(6)(3+) complex to be reduced to Ru(NH3)(6)(2+) which undergoes immediate desorption. When applied to a gold coated quartz crystal microbalance (QCM) sensor, electrochemically driven adsorption and desorption processes in the mesoporous structure become directly detectable as a frequency response, which corresponds directly to a mass or density change in the membrane. The frequency response (at least for thin films) is proportional to the thickness of the mass-responsive film, which suggests good mechanical coupling between electrode and film. Based on this observation, a method for the amplified QCM detection of small mass/density changes is proposed by conducting measurements in rigid mesoporous structures. (C) 2003 Elsevier Science B.V. All rights reserved.

Detection of polycyclic aromatic hydrocarbons using quartz crystal microbalances

A chemically coated piezoelectric sensor has been developed for the determination of PAHs in the liquid phase. An organic monolayer attached to the surface of a gold electrode of a quartz crystal microbalance (QCM) via a covalent thiol-gold link complete with an ionically bound recognition element has been produced. This study has employed the PAH derivative 9-anthracene carboxylic acid which, once bound to the alkane thiol, functions as the recognition element. Binding of anthracene via pi-pi interaction has been observed as a frequency shift in the QCM with a detectability of the target analyte of 2 ppb and a response range of 0-50 ppb. The relative response of the sensor altered for different PAHs despite pi-pi interaction being the sole communication between recognition element and analyte. It is envisaged that such a sensor could be employed in the identification of key marker compounds and, as such, give an indication of total PAH flux in the environment.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Mechanistic insights into a gas–solid reaction in molecular crystals: the role of hydrogen bonding

Reactions in (molecular) organic crystalline solids have been shown to be important for exerting control that is unattainable over chemical transformations in solution. Such control has also been achieved for reactions within metal– organic cages. In these examples, the reactants are already in place within the crystals following the original crystal growth. The post-synthetic modification of metal–organic frameworks (MOFs and indeed reactions and catalysis within MOFs have been recently demonstrated; in these cases the reactants enter the crystals through permanent channels. Another growing area of interest within molecular solid-state chemistry is synthesis by mechanical co-grinding of solid reactants—often referred to as mechanochemistry. Finally, in a small number of reported examples, molecules also have been shown to enter nonporous crystals directly from the gas or vapor phase, but in only a few of these examples does a change in covalent bonding result, which indicates that a reaction occurs within the nonporous crystals. It is this latter type of highly uncommon reaction that is the focus of the present study.

Pyrene-Modified quartz crystal microbalance for the detection of polynitroaromatic compounds

The synthesis of a dithiol-functionalized pyrene derivative is reported, together with studies of interactions between this receptor (and other related pyrenes) and nitroaromatic compounds (NACs), in both solution and in the solid state. Spectroscopic analysis in solution and X-ray crystallographic analysis of cocrystals of pyrene and NACs in the solid state indicate that supramolecular interactions lead to the formation of defined pi-pi stacked complexes. The dithiolfunctionalized pyrene derivative can be used to modify the surface of a gold quartz crystal microbalance (QCM) to create a unique π-electron rich surface, which is able to interact with electron poor aromatic compounds. For example, exposure of the modified QCM surface to the nitroaromatic compound 2,4-dinitrotoluene (DNT) in solution results in a reduction in the resonant frequency of the QCM as a result of supramolecular interactions between the electron-rich pyrenyl surface layer and the electron-poor DNT molecules. These results suggest the potential use of such modified QCM surfaces for the detection of explosive NACs.

Ice crystals growing from vapor in supercooled clouds between −2.5° and −22°C: testing current parameterization methods using laboratory data

The physical and empirical relationships used by microphysics schemes to control the rate at which vapor is transferred to ice crystals growing in supercooled clouds are compared with laboratory data to evaluate the realism of various model formulations. Ice crystal growth rates predicted from capacitance theory are compared with measurements from three independent laboratory studies. When the growth is diffusion- limited, the predicted growth rates are consistent with the measured values to within about 20% in 14 of the experiments analyzed, over the temperature range −2.5° to −22°C. Only two experiments showed significant disagreement with theory (growth rate overestimated by about 30%–40% at −3.7° and −10.6°C). Growth predictions using various ventilation factor parameterizations were also calculated and compared with supercooled wind tunnel data. It was found that neither of the standard parameterizations used for ventilation adequately described both needle and dendrite growth; however, by choosing habit-specific ventilation factors from previous numerical work it was possible to match the experimental data in both regimes. The relationships between crystal mass, capacitance, and fall velocity were investigated based on the laboratory data. It was found that for a given crystal size the capacitance was significantly overestimated by two of the microphysics schemes considered here, yet for a given crystal mass the growth rate was underestimated by those same schemes because of unrealistic mass/size assumptions. The fall speed for a given capacitance (controlling the residence time of a crystal in the supercooled layer relative to its effectiveness as a vapor sink, and the relative importance of ventilation effects) was found to be overpredicted by all the schemes in which fallout is permitted, implying that the modeled crystals reside for too short a time within the cloud layer and that the parameterized ventilation effect is too strong.

Evolution of network structure in polymer-stabilised liquid crystals

Experiments were performed to investigate the evolution of structure and morphology of the network in polymer-stabilised liquid crystals. In situ optical microscopy revealed that the morphology was significantly altered by extraction of the LC host, while scanning electron microscopy showed that the network morphology was also dependent on the polymerisation conditions and closely related to the depletion of monomer, as monitored by high performance liquid chromatography. Transmission electron microscopy allowed observation of internal structure, resolving microstructure on the order of 0. 1 μm.

A novel study of the polymerisation process involved in the formation of the network component of polymer-stabilised liquid crystals within electro-optic cells using high performance liquid chromatography

Polymer-stabilised liquid crystals are systems in which a small amount of monomer is dissolved within a liquid crystalline host, and then polymerised in situ to produce a network. The progress of the polymerisation, performed within electro-optic cells, was studied by establishing an analytical method novel to these systems. Samples were prepared by photopolymerisation of the monomer under well-defined reaction conditions; subsequent immersion in acetone caused the host and any unreacted monomer to dissolve. High performance liquid chromatography was used to separate and detect the various solutes in the resulting solutions, enabling the amount of unreacted monomer for a given set of conditions to be quantified. Longer irradiations cause a decrease in the proportion of unreacted monomer since more network is formed, while a more uniform LC director alignment (achieved by decreasing the sample thickness) or a higher level of order (achieved by decreasing the polymerisation temperature) promotes faster reactions.

Photo-induced phase transitions in azobenzene-doped liquid crystals

The effect of irradiation (UV-visible light) on a nematic liquid crystal doped with a photoactive azobenzene derivative was investigated. The selective irradiation results in either an E implies Z or Z implies E isomerization of the azobenzene unit. The effect of the isomerization is to cause a reversible depression of the liquid crystal to isotropic (LC implies l) phase transition temperature of the doped mixture, which can be monitored optically as an isothermal phase transition. This depression also results in a biphasic liquid crystal+isotropic region which is discussed. The authors investigate the cause and magnitude of the phase depression as a function of the amount of doped 4-butyl-4'-methoxyazobenzene (photoactive unit) in 4-cyano-4'-n-pentylbiphenyl (liquid crystal unit), and as a function of the percentage conversion of E implies Z (caused by isomerization) in the azobenzene. The photostationary state of the doped mixtures achieved by Z implies E isomerization is considered and its effect upon the transition temperature of the mixture and response time of the system is discussed. They discuss the implications of the photostationary state with regards to the reversibility of the photo-induced phase transition and hence potential applications.

The effect of the spacer length on the nature of coupling in side chain liquid crystals polymers and elastomers

Side chain liquid crystal polymers and elastomers exhibit a rich phase behaviour which arises from the antagonistic influences of the entropically disordered polymer chain configuration and the long range orientational ordering of the mesogenic units. This competition arises since the natural macroscopic phase separation is inhibited by the inherent chemical connectivity of the system. At the heart of this connectivity is the spacer link and we consider here its influence on the phase behaviour. In particular we consider a series of elastomers in which the number of alkyl units in the spacer is systematically varied from 2 to 6. The lengthening of the coupling spacer is accompanied by an alternation of the sign of coupling between the polymer chain and the mesogenic unit. These results demonstrate the dominating influence of the so-called hinge effect in determining the phase behaviour. In addition to the alternation of the sign there is some decrease in the magnitude of the coupling with increasing spacer length.

WAXS studies of global molecular orientation induced in nematic liquid crystals by simple shear flow

Global molecular orientation function coefficients for the nematic liquid crystal 4-cyano 4'-nn -pentylbiphenyl (5CB) in shear flow are presented, being extracted from 2-dimensional Wide-Angle X-ray Scattering data. A linear increase in orientation parameter P2 is observed with a logarithmic increase in shear rate. It is proposed that this arises from an increased number of LC directors aligning to the shear axis. Upon cessation of shear flow, the anisotropy is seen to relax away completely, over a time scale which is inversely proportional to the previously applied shear rate.