968 resultados para ENDOTHELIAL PROGENITOR CELL
Resumo:
Vesicles containing endothelin 1 (ET-1) were isolated from bovine aortic endothelial cells (BAECs) by fractionation of homogenates on sucrose density gradients by ultracentrifugation. The vesicles were localized at the 1.0/1.2 M sucrose interface using a specific anti-ET-1-(16-21) RIA. Identification of ET-1 and big ET-1 in this fraction was confirmed by HPLC analysis combined with RIA. Morphological examination of the ET-1-enriched fraction by electron microscopy identified clusters of vesicles approximately 100 nm in diameter. Immunostaining of ultrathin cryosections prepared from the vesicle fraction for ET-1 or big ET-1 showed clusters of 15-nm gold particles attached to or within vesicles. Immunofluorescence staining of whole BAECs using a specific ET-1-(16-21) IgG purified by affinity chromatography revealed punctate granulation of the cell cytoplasm viewed under light microscopy. This distinct pattern of staining was shown by confocal light microscopy to be intracellular. Immunofluorescence staining of whole cells with a polyclonal antiserum for big ET-1-(22-39) showed a defined perinuclear localization of precursor molecule. Hence, several different approaches have demonstrated that ET-1 and big ET-1 are localized within intracellular vesicles in BAECs, suggesting that these subcellular compartments are an important site for processing of big ET-1 by endothelin-converting enzyme.
Resumo:
Cultured human umbilical vein endothelial cells (EC) constitutively express a low level of CD40 antigen as detected by monoclonal antibody binding and fluorescence flow cytometric quantitation. The level of expression on EC is increased about 3-fold following 24 h treatment with optimal concentrations of tumor necrosis factor, interleukin 1, interferon beta, or interferon gamma; both interferons show greater than additive induction of CD40 when combined with tumor necrosis factor or interleukin 1. Expression of CD40 increases within 8 h of cytokine treatment and continues to increase through 72 h. A trimeric form of recombinant murine CD40 ligand acts on human EC to increase expression of leukocyte adhesion molecules, including E-selectin, vascular cell adhesion molecule 1, and intercellular adhesion molecule 1. CD40 may be detected immunocytochemically on human microvascular EC in normal skin. We conclude that endothelial CD40 may play a role as a signaling receptor in the development of T-cell-mediated inflammatory reactions.
Resumo:
The present study was undertaken to define the 5' and 3' regulatory sequences of human von Willebrand factor gene that confer tissue-specific expression in vivo. Transgenic mice were generated bearing a chimeric construct that included 487 bp of 5' flanking sequence and the first exon fused in-frame to the Escherichia coli lacZ gene. In situ histochemical analyses in independent lines demonstrated that the von Willebrand factor promoter targeted expression of LacZ to a subpopulation of endothelial cells in the yolk sac and adult brain. LacZ activity was absent in the vascular beds of the spleen, lung, liver, kidney, testes, heart, and aorta, as well as in megakaryocytes. In contrast, in mice containing the lacZ gene targeted to the thrombomodulin locus, the 5-bromo-4-chloro-3-indolyl beta-D-galactopyranoside reaction product was detected throughout the vascular tree. These data highlight the existence of regional differences in endothelial cell gene regulation and suggest that the 733-bp von Willebrand factor promoter may be useful as a molecular marker to investigate endothelial cell diversity.
Resumo:
Wound repair and tumor vascularization depend upon blood vessel growth into hypoxic tissue. Although hypoxia slows endothelial cell (EC) proliferation and suppresses EC basic fibroblast growth factor (bFGF) expression, we report that macrophages (MPs) exposed to PO2 approximately 12-14 torr (1 torr = 133.3 Pa) synthesize and release in a time-dependent manner platelet-derived growth factor (PDGF) and acidic/basic FGFs (a/bFGFs), which stimulate the growth of hypoxic ECs. Chromatography of hypoxic MP-conditioned medium on immobilized heparin with an ascending NaCl gradient resolved three peaks of mitogenic activity: activity of the first peak was neutralized by antibody to PDGF; activity of the second peak was neutralized by antibody to aFGF; and activity of the third peak was neutralized by antibody to bFGF. Metabolically labeled lysates and supernatants from MPs exposed to hypoxia showed increased synthesis and release of immunoprecipitable PDGF and a/bFGF in the absence of changes in cell viability. Possible involvement of a heme-containing oxygen sensor in MP elaboration of growth factors was suggested by the induction of bFGF and PDGF by normoxic MPs exposed to nickel or cobalt, although metabolic inhibitors such as sodium azide were without effect. These results suggest a paracrine model in which hypoxia stimulates MP release of PDGF and a/bFGF, inducing EC proliferation and potentially promoting angiogenesis in hypoxic environments.
Resumo:
Mucosal vascular addressin cell adhesion molecule 1 (MAdCAM-1) is involved in trafficking of lymphocytes to mucosal endothelium. Expression of MAdCAM-1 is induced in the murine endothelial cell line bEnd.3 by tumor necrosis factor alpha (TNF-alpha), interleukin 1, and bacterial lipopolysaccharide. Here we show that TNF-alpha enhances expression of a firefly luciferase reporter directed by the MAdCAM-1 promoter, confirming transcriptional regulation of MAdCAM-1. Mutational analysis of the promoter indicates that a DNA fragment extending from nt -132 to nt +6 of the gene is sufficient for TNF-alpha inducibility. Two regulatory sites critical for TNF-alpha induction were identified in this region. DNA-binding experiments demonstrate that NF-kappa B proteins from nuclear extracts of TNF-alpha-stimulated bEnd.3 cells bind to these sites, and transfection assays with promoter mutants of the MAdCAM-1 gene indicate that occupancy of both sites is essential for promoter function. The predominant NF-kappa B binding activity detected with these nuclear extracts is a p65 homodimer. These findings establish that, as with other endothelial cell adhesion molecules, transcriptional induction of MAdCAM-1 by TNF-alpha requires activated NF-kappa B proteins.
Resumo:
Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.
Resumo:
We have studied the effect of inactivated microbial stimuli (Candida albicans, Candida glabrata, Saccharomyces boulardii, and Staphylococcus aureus) on the in vitro differentiation of lineage negative (Lin−) hematopoietic progenitor mouse cells. Purified Lin− progenitors were co-cultured for 7 days with the stimuli, and cell differentiation was determined by flow cytometry analysis. All the stimuli assayed caused differentiation toward the myeloid lineage. S. boulardii and particularly C. glabrata were the stimuli that induced in a minor extent differentiation of Lin− cells, as the major population of differentiated cells corresponded to monocytes, whereas C. albicans and S. aureus induced differentiation beyond monocytes: to monocyte-derived dendritic cells and macrophages, respectively. Interestingly, signaling through TLR2 by its pure ligand Pam3CSK4 directed differentiation of Lin− cells almost exclusively to macrophages. These data support the notion that hematopoiesis can be modulated in response to microbial stimuli in a pathogen-dependent manner, being determined by the pathogen-associated molecular patterns and the pattern-recognition receptors involved, in order to generate the populations of mature cells required to deal with the pathogen.
Resumo:
Il est reconnu que la protéine filamenteuse intermédiaire Nestine est exprimée lors du processus de cicatrisation et du remodelage fibrotique. De plus, nous avons identifié l’expression de la Nestine au sein de deux populations distinctes qui sont directement impliquées dans les réponses de fibroses réparative et réactive. Ainsi, une population de cellules souches neurales progénitrices résidentes du coeur de rat adulte exprime la Nestine et a été identifiée à titre de substrat de l’angiogenèse et de la neurogenèse cardiaque. Également, la Nestine est exprimée par les myofibroblastes cicatriciels cardiaques et il a été établi que la protéine filamenteuse intermédiaire joue un rôle dans la prolifération de ces cellules. Ainsi, l’objectif général de cette thèse était de mieux comprendre les évènements cellulaires impliqués dans la réponse neurogénique des cellules souches neurales progénitrices résidentes cardiaques Nestine(+) (CSNPRCN(+)) lors de la fibrose réparative cardiaque et d’explorer si l’apparition de fibroblastes Nestine(+) est associée avec la réponse de fibrose réactive secondaire du remodelage pulmonaire. Une première publication nous a permis d’établir qu’il existe une régulation à la hausse de l’expression de la GAP43 (growth associated protein 43) et que cet événement transitoire précède l’acquisition d’un phénotype neuronal par les CSNPRCN(+) lors du processus de cicatrisation cardiaque chez le rat ayant subi un infarctus du myocarde. De plus, la surimposition de la condition diabétique de type 1, via l’injection unique de Streptozotocine chez le rat, abolit la réponse neurogénique des CSNPRCN(+), qui est normalement induite à la suite de l’ischémie cardiaque ou de l’administration de 6-hydroxydopamine. Le second article a démontré que le développement aigu de la fibrose pulmonaire secondaire de l’infarctus du myocarde chez le rat est associé avec une augmentation de l’expression protéique de la Nestine et de l’apparition de myofibroblastes pulmonaires Nestine(+). Également, le traitement de fibroblastes pulmonaires avec des facteurs de croissances peptidiques pro-fibrotiques a augmenté l’expression de la Nestine par ces cellules. Enfin, le développement initial de la condition diabétique de type 1 chez le rat est associé avec une absence de fibrose réactive pulmonaire et à une réduction significative des niveaux protéiques et d’ARN messager de la Nestine pulmonaire. Finalement, la troisième étude représentait quant à elle un prolongement de la deuxième étude et a alors examiné le remodelage pulmonaire chronique chez un modèle établi d’hypertension pulmonaire. Ainsi, les poumons de rats adultes mâles soumis à l’hypoxie hypobarique durant 3 semaines présentent un remodelage vasculaire, une fibrose réactive et une augmentation des niveaux d’ARN messager et de la protéine Nestine. De plus, nos résultats ont démontré que la Nestine, plutôt que l’alpha-actine du muscle lisse, est un marqueur plus approprié des diverses populations de fibroblastes pulmonaires activés. Également, nos données suggèrent que les fibroblastes pulmonaires activés proviendraient en partie de fibroblastes résidents, ainsi que des processus de transition épithélio-mésenchymateuse et de transition endothélio-mésenchymateuse. Collectivement, ces études ont démontré que des populations distinctes de cellules Nestine(+) jouent un rôle majeur dans la fibrose réparative cardiaque et la fibrose réactive pulmonaire.
Resumo:
Angiogenesis is an essential physiological process and an important factor in disease pathogenesis. However, its exploitation as a clinical target has achieved limited success and novel molecular targets are required. Although heme oxygenase-1 (HO-1) acts downstream of vascular endothelial growth factor (VEGF) to modulate angiogenesis, knowledge of the mechanisms involved remains limited. We set out identify novel HO-1 targets involved in angiogenesis. HO-1 depletion attenuated VEGF-induced human endothelial cell (EC) proliferation and tube formation. The latter response suggested a role for HO-1 in EC migration, and indeed HO-1 siRNA negatively affected directional migration of EC towards VEGF; a phenotype reversed by HO-1 over-expression. EC from Hmox1(-/-) mice behaved similarly. Microarray analysis of HO-1-depleted and control EC exposed to VEGF identified cyclins A1 and E1 as HO-1 targets. Migrating HO-1-deficient EC showed increased p27, reduced cyclin A1 and attenuated cyclin-dependent kinase 2 activity. In vivo, cyclin A1 siRNA inhibited VEGF-driven angiogenesis, a response reversed by Ad-HO-1. Proteomics identified structural protein vimentin as an additional VEGF-HO-1 target. HO-1 depletion inhibited VEGF-induced calpain activity and vimentin cleavage, while vimentin silencing attenuated HO-1-driven proliferation. Thus, vimentin and cyclins A1 and E1 represent VEGF-activated HO-1-dependent targets important for VEGF-driven angiogenesis.
Resumo:
Sickle cell anemia (SCA) is an autosomal recessive chronic hemolytic anemia, caused by homozygosity for the HBB:c.20A>T mutation. The disease presents with high clinical heterogeneity, stroke being the most devastating manifestation. This study aimed to identify genetic modulators of severe hemolysis and stroke risk in children with SCA, as well as understand their consequences at the hemorheological level. Sixty-six children with SCA were categorised according to their degree of cerebral vasculopathy (Stroke/Risk/Control). Relevant data were collected from patients’ medical records. Several polymorphic regions in genes related to vascular cell adhesion and tonus were characterized by molecular methodologies. Data analyses were performed using R software. Several in silico tools (e.g. TFBind, MatInspector) were applied to investigate the main variant consequences. Some genetic variants in vascular adhesion molecule-1 gene promoter and endothelial nitric oxide synthase gene were associated with higher levels of hemolysis and stroke events. They modify important transcription factor binding sites or disturb the corresponding protein structure/function. Our findings emphasize the relevance of the genetic variants in modulating the degree of hemolysis and development of cerebral vasculopathy due to their effect on gene expression, modification of protein biological activities related with erythrocyte/endothelial interactions and consequent hemorheological abnormalities in SCA.
Resumo:
PURPOSE To evaluate macular retinal ganglion cell thickness in patients with neovascular age-related macular degeneration (AMD) and intravitreal anti-vascular endothelial growth factor (VEGF) therapy. DESIGN Retrospective case series with fellow-eye comparison METHODS: Patients with continuous unilateral anti-VEGF treatment for sub- and juxtafoveal neovascular AMD and a minimum follow-up of 24 months were included. The retinal nerve fiber (RNFL) and retinal ganglion cell layer (RGCL) in the macula were segmented using an ETDRS grid. RNFL and RGCL thickness of the outer ring of the ETDRS grid were quantified at baseline and after repeated anti-VEGF injections, and compared to the patients' untreated fellow eye. Furthermore, best-corrected visual acuity (BCVA), age, and retinal pigment epithelium (RPE) atrophy were recorded and correlated with RNFL and RGCL. RESULTS Sixty eight eyes of 34 patients (23 female and 11 male; mean age 76.7 (SD±8.2) with a mean number of 31.5 (SD ±9.8) anti-VEGF injections and a mean follow-up period of 45.3 months (SD±10.5) were included. Whereas the RGCL thickness decreased significantly compared to the non-injected fellow eye (p=0.01) the decrease of the RNFL was not significant. Visual acuity gain was significantly correlated with RGCL thickness (r=0.52, p<0.05) at follow-up and negatively correlated (r=-0.41, p<0.05) with age. Presence of RPE atrophy correlated negatively with the RGCL thickness at follow-up (r= -0.37, p=0.03). CONCLUSION During the course of long term anti-VEGF therapy there is a significant decrease of the RGCL in patients with neovascular AMD to the fellow (untreated) eye.
Resumo:
Thesis (Ph.D.)--University of Washington, 2016-06
Resumo:
Individuals with periodontitis have been reported to have a significantly increased risk of developing coronary heart disease. Several studies have demonstrated that the immune response to heat shock protein 60 (HSP60) may be involved in the pathogenesis of both atherosclerosis and chronic periodontitis. To investigate this possible link between these diseases, cellular and humoral immune responses to HSP60 in atherosclerosis patients were compared with those in periodontitis patients and healthy subjects using human and Porphyromonas gingivalis HSP60 (GroEL) as antigens. Antibody levels to both human and P. gingivalis HSP60s were the highest in atherosclerosis patients, followed by periodontitis patients and healthy subjects. Clonal analysis of the T cells clearly demonstrated the presence of not only human HSP60- but also P. gingivalis GroEL-reactive T-cell populations in the peripheral circulation of atherosclerosis patients. Furthermore, these HSP60-reactive T cells seemed to be present in atherosclerotic lesions in some patients. These results suggest that T-cell clones with the same specificity may be involved in the pathogenesis of the different diseases.
Resumo:
Although many of the molecular interactions in kidney development are now well understood, the molecules involved in the specification of the metanephric mesenchyme from surrounding intermediate mesoderm and, hence, the formation of the renal progenitor population are poorly characterized. In this study, cDNA microarrays were used to identify genes enriched in the murine embryonic day 10.5 (E10.5) uninduced metanephric mesenchyme, the renal progenitor population, in comparison with more rostral derivatives of the intermediate mesoderm. Microarray data were analyzed using R statistical software to determine accurately genes differentially expressed between these populations. Microarray outliers were biologically verified, and the spatial expression pattern of these genes at E10.5 and subsequent stages of early kidney development was determined by RNA in situ hybridization. This approach identified 21 genes preferentially expressed by the E10.5 metanephric mesenchyme, including Ewing sarcoma homolog, 14-3-3 theta, retinoic acid receptor-alpha, stearoyl-CoA desaturase 2, CD24, and cadherin-11, that may be important in formation of renal progenitor cells. Cell surface proteins such as CD24 and cadherin-11 that were strongly and specifically expressed in the uninduced metanephric mesenchyme and mark the renal progenitor population may prove useful in the purification of renal progenitor cells by FACS. These findings may assist in the isolation and characterization of potential renal stem cells for use in cellular therapies for kidney disease.
Resumo:
The expression and function of nicotinic ACh receptors (nAChRs) in rat coronary microvascular endothelial cells (CMECs) were examined using RT-PCR and whole cell patch-clamp recording methods. RT-PCR revealed expression of mRNA encoding for the subunits alpha(2), alpha(3), alpha(4), alpha(5), alpha(7), beta(2), and beta(4) but not beta(3). Focal application of ACh evoked an inward current in isolated CMECs voltage clamped at negative membrane potentials. The current-voltage relationship of the ACh-induced current exhibited marked inward rectification and a reversal potential (E-rev) close to 0 mV. The cholinergic agonists nicotine, epibatidine, and cytisine activated membrane currents similar to those evoked by ACh. The nicotine-induced current was abolished by the neuronal nAChR antagonist mecamylamine. The direction and magnitude of the shift in E-rev of nicotine-induced current as a function of extracellular Na+ concentration indicate that the nAChR channel is cation selective and follows that predicted by the Goldman-Hodgkin-Katz equation assuming K+/Na+ permeability ratio of 1.11. In fura-2-loaded CMECs, application of ACh, but not of nicotine, elicited a transient increase in intracellular free Ca2+ concentration. Taken together, these results demonstrate that neuronal nAChR activation by cholinergic agonists evokes an inward current in CMECs carried primarily by Na+, which may contribute to the plasma nicotine-induced changes in microvascular permeability and reactivity induced by elevations in plasma nicotine.