997 resultados para Dna vaccines
Resumo:
Background: Two or three DNA primes have been used in previous smaller clinical trials, but the number required for optimal priming of viral vectors has never been assessed in adequately powered clinical trials. The EV03/ANRS Vac20 phase I/II trial investigated this issue using the DNA prime/poxvirus NYVAC boost combination, both expressing a common HIV-1 clade C immunogen consisting of Env and Gag-Pol-Nef polypeptide. Methods: 147 healthy volunteers were randomly allocated through 8 European centres to either 3xDNA plus 1xNYVAC (weeks 0, 4, 8 plus 24; n¼74) or to 2xDNA plus 2xNYVAC (weeks 0, 4 plus 20, 24; n¼73), stratified by geographical region and sex. T cell responses were quantified using the interferon g Elispot assay and 8 peptide pools; samples from weeks 0, 26 and 28 (time points for primary immunogenicity endpoint), 48 and 72 were considered for this analysis. Results: 140 of 147 participants were evaluable at weeks 26 and/ or 28. 64/70 (91%) in the 3xDNA arm compared to 56/70 (80%) in the 2xDNA arm developed a T cell response (P¼0.053). 26 (37%) participants of the 3xDNA arm developed a broader T cell response (Env plus at least to one of the Gag, Pol, Nef peptide pools) versus 15 (22%) in the 2xDNA arm (P¼0.047). At week 26, the overall magnitude of responses was also higher in the 3xDNA than in the 2xDNA arm (similar at week 28), with a median of 545 versus 328 SFUs/106 cells at week 26 (P<0.001). Preliminary overall evaluation showed that participants still developed T-cell response at weeks 48 (78%, n¼67) and 72 (70%, n¼66). Conclusion: This large clinical trial demonstrates that optimal priming of poxvirus-based vaccine regimens requires 3 DNA regimens and further confirms that the DNA/NYVAC prime boost vaccine combination is highly immunogenic and induced durable T-cell responses.
Resumo:
INTRODUCTION: Glioblastoma multiforme (GBM; World Health Organization astrocytoma grade IV) is the most frequent and most malignant primary brain tumor in adults. Despite multimodal therapy, all such tumors practically recur during the course of therapy, causing a median survival of only 14.6 months in patients with newly diagnosed GBM. The present study was aimed at examining the expression of the DNA repair protein AlkB homolog 2 (ALKBH2) in human GBM and determining whether it could promote resistance to temozolomide chemotherapy. METHODS: ALKBH2 expression in GBM cell lines and in human GBM was determined by quantitative real-time PCR (qRT-PCR) and gene expression analysis, respectively. Drug sensitivity was assessed in GBM cells overexpressing ALKBH2 and in cells in which ALKBH2 expression was silenced by small-interfering (si)RNA. ALKBH2 expression following activation of the p53 pathway was examined by western blotting and qRT-PCR. RESULTS: ALKBH2 was abundantly expressed in established GBM cell lines and human GBM, and temozolomide exposure increased cellular ALKBH2 expression levels. Overexpression of ALKBH2 in the U87 and U251 GBM cell lines enhanced resistance to the methylating agents temozolomide and methyl methanesulfonate but not to the nonmethylating agent doxorubicin. Conversely, siRNA-mediated knockdown of ALKBH2 increased sensitivity of GBM cells to temozolomide and methyl methanesulfonate but not to doxorubicin or cisplatin. Nongenotoxic activation of the p53 pathway by the selective murine double minute 2 antagonist nutlin-3 caused a significant decrease in cellular ALKBH2 transcription levels. CONCLUSION: Our findings identify ALKBH2 as a novel mediator of temozolomide resistance in human GBM cells. Furthermore, we place ALKBH2 into a new cellular context by showing its regulation by the p53 pathway.
Resumo:
The estrogen-responsive element (ERE) present in the 5'-flanking region of the Xenopus laevis vitellogenin (vit) gene B1 has been characterized by transient expression analysis of chimeric vit-tk-CAT (chloramphenicol acetyltransferase) gene constructs transfected into the human estrogen-responsive MCF-7 cell line. The vit B1 ERE behaves like an inducible enhancer, since it is able to confer estrogen inducibility to the heterologous HSV thymidine kinase (tk) promoter in a relative position- and orientation-independent manner. In this assay, the minimal B1 ERE is 33 bp long and consists of two 13 bp imperfect palindromic elements both of which are required for the enhancer activity. A third imperfect palindromic element is present further upstream within the 5'-flanking region of the gene but is unable to confer hormone responsiveness by itself. Similarly, neither element forming the B1 ERE can alone confer estrogen inducibility to the tk promoter. However, in combinations of two, all three imperfect palindromes can act cooperatively to form a functional ERE. In contrast a single 13 bp perfect palindromic element, GGTCACTGTGACC, such as the one found upstream of the vit gene A2, is itself sufficient to act as a fully active ERE. Single point mutations within this element abolish estrogen inducibility, while a defined combination of two mutations converts this ERE into a glucocorticoid-responsive element.
Biological embedding of early-life exposures and disease risk in humans : a role for DNA methylation
Resumo:
BACKGROUND: Following wider acceptance of 'the thrifty phenotype' hypothesis and the convincing evidence that early-life exposures can influence adult health even decades after the exposure, much interest has been placed on the mechanisms through which early-life exposures become biologically embedded. MATERIALS AND METHODS: In this review, we summarize the current literature regarding biological embedding of early-life experiences. To this end, we conducted a literature search to identify studies investigating early-life exposures in relation to DNA methylation changes. In addition, we summarize the challenges faced in investigations of epigenetic effects, stemming from the peculiarities of this emergent and complex field. A proper systematic review and meta-analyses were not feasible given the nature of the evidence. RESULTS: We identified seven studies on early-life socio-economic circumstances, 10 studies on childhood obesity and six studies on early-life nutrition all relating to DNA methylation changes that met the stipulated inclusion criteria. The pool of evidence gathered, albeit small, favours a role of epigenetics and DNA methylation in biological embedding, but replication of findings, multiple comparison corrections, publication bias and causality are concerns remaining to be addressed in future investigations. CONCLUSIONS: Based on these results, we hypothesize that epigenetics, in particular DNA methylation, is a plausible mechanism through which early-life exposures are biologically embedded. This review describes the current status of the field and acts as a stepping stone for future, better designed investigations on how early-life exposures might become biologically embedded through epigenetic effects.
Resumo:
Initiation of Bacillus subtilis bacteriophage SPP1 replication requires the phage-encoded genes 38, 39 and 40 products (G38P, G39P and G40P). G39P, which does not bind DNA, interacts with the replisome organiser, G38P, in the absence of ATP and with the ATP-activated hexameric replication fork helicase, G40P. G38P, which specifically interacts with the phage replication origin (oriL) DNA, does not seem to form a stable complex with G40P in solution. G39P when complexed with G40P-ATP inactivates the single-stranded DNA binding, ATPase and unwinding activities of G40P, and such effects are reversed by increasing amounts of G38P. Unwinding of a forked substrate by G40P-ATP is increased about tenfold by the addition of G38P and G39P to the reaction mixture. The specific protein-protein interactions between oriL-bound G38P and the G39P-G40P-ATPgammaS complex are necessary for helicase delivery to the SPP1 replication origin. Formation of G38P-G39P heterodimers releases G40P-ATPgammaS from the unstable oriL-G38P-G39P-G40P-ATPgammaS intermediate. G40P-ATPgammaS binds to the origin region, the uncomplexed G38P fraction remains bound to oriL, and the G38P-G39P heterodimer is lost from the complex. We demonstrate that G39P is a component of an oligomeric nucleoprotein complex which plays an important role in the initiation of SPP1 replication.
Resumo:
Based on the partial efficacy of the HIV/AIDS Thai trial (RV144) with a canarypox vector prime and protein boost, attenuated poxvirus recombinants expressing HIV-1 antigens are increasingly sought as vaccine candidates against HIV/AIDS. Here we describe using systems analysis the biological and immunological characteristics of the attenuated vaccinia virus Ankara strain expressing the HIV-1 antigens Env/Gag-Pol-Nef of HIV-1 of clade C (referred as MVA-C). MVA-C infection of human monocyte derived dendritic cells (moDCs) induced the expression of HIV-1 antigens at high levels from 2 to 8 hpi and triggered moDCs maturation as revealed by enhanced expression of HLA-DR, CD86, CD40, HLA-A2, and CD80 molecules. Infection ex vivo of purified mDC and pDC with MVA-C induced the expression of immunoregulatory pathways associated with antiviral responses, antigen presentation, T cell and B cell responses. Similarly, human whole blood or primary macrophages infected with MVA-C express high levels of proinflammatory cytokines and chemokines involved with T cell activation. The vector MVA-C has the ability to cross-present antigens to HIV-specific CD8 T cells in vitro and to increase CD8 T cell proliferation in a dose-dependent manner. The immunogenic profiling in mice after DNA-C prime/MVA-C boost combination revealed activation of HIV-1-specific CD4 and CD8 T cell memory responses that are polyfunctional and with effector memory phenotype. Env-specific IgG binding antibodies were also produced in animals receiving DNA-C prime/MVA-C boost. Our systems analysis of profiling immune response to MVA-C infection highlights the potential benefit of MVA-C as vaccine candidate against HIV/AIDS for clade C, the prevalent subtype virus in the most affected areas of the world.
Resumo:
In order to contribute to the debate about southern glacial refugia used by temperate species and more northern refugia used by boreal or cold-temperate species, we examined the phylogeography of a widespread snake species (Vipera berus) inhabiting Europe up to the Arctic Circle. The analysis of the mitochondrial DNA (mtDNA) sequence variation in 1043 bp of the cytochrome b gene and in 918 bp of the noncoding control region was performed with phylogenetic approaches. Our results suggest that both the duplicated control region and cytochrome b evolve at a similar rate in this species. Phylogenetic analysis showed that V. berus is divided into three major mitochondrial lineages, probably resulting from an Italian, a Balkan and a Northern (from France to Russia) refugial area in Eastern Europe, near the Carpathian Mountains. In addition, the Northern clade presents an important substructure, suggesting two sequential colonization events in Europe. First, the continent was colonized from the three main refugial areas mentioned above during the Lower-Mid Pleistocene. Second, recolonization of most of Europe most likely originated from several refugia located outside of the Mediterranean peninsulas (Carpathian region, east of the Carpathians, France and possibly Hungary) during the Mid-Late Pleistocene, while populations within the Italian and Balkan Peninsulas fluctuated only slightly in distribution range, with larger lowland populations during glacial times and with refugial mountain populations during interglacials, as in the present time. The phylogeographical structure revealed in our study suggests complex recolonization dynamics of the European continent by V. berus, characterized by latitudinal as well as altitudinal range shifts, driven by both climatic changes and competition with related species.
Resumo:
GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.
Resumo:
Although melanoma vaccines stimulate tumor antigen-specific CD8(+) T cells, objective clinical responses are rarely observed. To investigate this discrepancy, we evaluated the character of vaccine-induced CD8(+) T cells with regard to the inhibitory T-cell coreceptors PD-1 and Tim-3 in patients with metastatic melanoma who were administered tumor vaccines. The vaccines included incomplete Freund's adjuvant, CpG oligodeoxynucleotide (CpG), and the HLA-A2-restricted analog peptide NY-ESO-1 157-165V, either by itself or in combination with the pan-DR epitope NY-ESO-1 119-143. Both vaccines stimulated rapid tumor antigen-specific CD8(+) T-cell responses detected ex vivo, however, tumor antigen-specific CD8(+) T cells produced more IFN-γ and exhibited higher lytic function upon immunization with MHC class I and class II epitopes. Notably, the vast majority of vaccine-induced CD8(+) T cells upregulated PD-1 and a minority also upregulated Tim-3. Levels of PD-1 and Tim-3 expression by vaccine-induced CD8(+) T cells at the time of vaccine administration correlated inversely with their expansion in vivo. Dual blockade of PD-1 and Tim-3 enhanced the expansion and cytokine production of vaccine-induced CD8(+) T cells in vitro. Collectively, our findings support the use of PD-1 and Tim-3 blockades with cancer vaccines to stimulate potent antitumor T-cell responses and increase the likelihood of clinical responses in patients with advanced melanoma.
Resumo:
Kirjoitus on lisäys professorien Olli Halkan ja Veikko Sorsan artikkeleihin TT -lehdessä 2 ja 3/2004.
Resumo:
Vastine Olli Halkan kirjoitukseen TT -lehdessä 2/2004
Resumo:
Vastine TT -lehden numerossa 8/2003 olleeseen Jani Rydmanin kommenttiin Pekkan Nuortevan Luonnon tutkijassa olleeseen artikkeliin
Resumo:
NYVAC-C (vP2010), a recombinant vector expressing HIV subtype C gag, pol, env and nef antigens, was tested in a phase I study in healthy, HIV negative volunteers in London and Lausanne. Twenty-four participants were randomised to receive NYVAC-C (20) or matching placebo (4) at weeks 0 and 4, and assessed for safety and immunogenicity over 48 weeks. There were no serious adverse events, and no clinical or laboratory abnormalities or other events that led to withdrawal, interruption or dose reduction of the NYVAC-C/placebo. Half of the 10 assessed responded in the ELISpot assay under stringent criteria, which informed the sample size for a DNA-NYVAC-C comparison to NYVAC-C alone.