928 resultados para Differentially Expressed Genes
Resumo:
Early atherosclerotic lesions develop in a topographical pattern that strongly suggests involvement of hemodynamic forces in their pathogenesis. We hypothesized that certain endothelial genes, which exhibit differential responsiveness to distinct fluid mechanical stimuli, may participate in the atherogenic process by modulating, on a local level within the arterial wall, the effects of systemic risk factors. A differential display strategy using cultured human endothelial cells has identified two genes, manganese superoxide dismutase and cyclooxygenase-2, that exhibit selective and sustained up-regulation by steady laminar shear stress (LSS). Turbulent shear stress, a nonlaminar fluid mechanical stimulus, does not induce these genes. The endothelial form of nitric oxide synthase also demonstrates a similar LSS-selective pattern of induction. Thus, three genes with potential atheroprotective (antioxidant, antithrombotic, and antiadhesive) activities manifest a differential response to distinct fluid mechanical stimuli, providing a possible mechanistic link between endothelial gene expression and early events in atherogenesis. The activities of these and other LSS-responsive genes may have important implications for the pathogenesis and prevention of atherosclerosis.
Resumo:
Activity-dependent plasticity is thought to underlie both formation of appropriate synaptic connections during development and reorganization of adult cortical topography. We have recently cloned many candidate plasticity-related genes (CPGs) induced by glutamate-receptor activation in the hippocampus. Screening the CPG pool for genes that may contribute to neocortical plasticity resulted in the identification of six genes that are induced in adult visual cortical areas in response to light. These genes are also naturally induced during postnatal cortical development. CPG induction by visual stimulation occurs primarily in neurons located in cortical layers II-III and VI and persists for at least 48 hr. Four of the visually responsive CPGs (cpg2, cpg15, cpg22, cpg29) are previously unreported genes, one of which (cpg2) predicts a "mini-dystrophin-like" structural protein. These results lend molecular genetic support to physiological and anatomical studies showing activity-dependent structural reorganization in adult cortex. In addition, these results provide candidate genes the function of which may underlie mechanisms of adult cortical reorganization.
Resumo:
An immunological screening strategy was used to select microbial genes expressed only in the host. Differential screening of a Borrelia burgdorferi (the Lyme disease agent) expression library identified a gene (p21) encoding a 20.7-kDa antigen that reacted with antibodies in serum from actively infected mice but not serum from mice immunized with heat-killed B. burgdorferi. Selective expression of p21 in the infected host was confirmed by Northern blot analysis and RNA PCR. Further differential screening of the expression library identified at least five additional B. burgdorferi genes are selectively expressed in vivo. This screening method can be used to identify genes induced in vivo in a wide variety of pathogenic microorganisms for which a gene transfer system is not currently available.
Resumo:
The transcription factor NF-E2 (nuclear factor erythroid 2), interacting via DNA motifs within regulatory regions of several hematopoietic genes, is thought to mediate the enhancer activity of the globin locus control regions. By screening a human fetal liver cDNA library with probes derived from mouse NF-E2, we have isolated a splicing variant of the NF-E2 gene (fNF-E2) that differs in the 5' untranslated region from the previously reported cDNA (aNF-E2). The fNF-E2 isoform is transcribed from an alternative promoter located in the 3' end of the first intron and joined by alternative splicing to the second and third exons, which are shared by both RNA isoforms. Although the two forms produce the same protein, they are expressed in different ratios during development. fNF-E2 is more abundant in the fetal liver and less abundant in the adult bone marrow compared to the previously described form. Their distribution apparently follows the differential expression of fetal and adult hemoglobins.
Resumo:
Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.
Resumo:
Matrix proteins play important roles in tissue morphogenesis. We have studied the expression of genes encoding the related SIBLING glycoproteins osteopontin (OPN), bone sialoprotein (BSP), and dentin matrix protein (DMP) during the development of male and female gonads during mouse embryogenesis. Opn mRNA was expressed specifically by Sertoli cells of the developing testis cords, in the mesonephric tubules of both sexes, and, transiently, in the Mullerian ducts of both sexes, as determined by whole-mount and section in situ hybridization. OPN protein was detected in the cytoplasm of Sertoli cells and luminal cells of the mesonephric tubules, with small amounts associated with the plasma membrane of germ cells. We found no defects in developing testes of Opn-/- mice using a range of cell type-specific markers, suggesting that other SIBLING proteins may function in testis development. Dmp and Bsp mRNA was also expressed in the developing testis cords, supporting the view that all three SIBLING proteins may contribute to testis differentiation. (c) 2005 Wiley-Liss, Inc.
Resumo:
To identify genes involved in papaya fruit ripening, a total of 1171 expressed sequence tags (ESTs) were generated from randomly selected clones of two independent fruit cDNA libraries derived from yellow and red-fleshed fruit varieties. The most abundant sequences encoded: chitinase, 1-aminocyclopropane- 1-carboxylic acid (ACC) oxidase, catalase and methionine synthase, respectively. DNA sequence comparisons identified ESTs with significant similarity to genes associated with fruit softening, aroma and colour biosynthesis. Putative cell wall hydrolases, cell membrane hydrolases, and ethylene synthesis and regulation sequences were identified with predicted roles in fruit softening. Expressed papaya genes associated with fruit aroma included isoprenoid biosynthesis and shikimic acid pathway genes and proteins associated with acyl lipid catabolism. Putative fruit colour genes were identified due to their similarity with carotenoid and chlorophyll biosynthesis genes from other plant species. © 2005 Elsevier Ireland Ltd. All rights reserved.
Resumo:
The tropical abalone. Haliotis asinina. is,in ideal species to investigate the molecular mechanisms that control development. growth, reproduction and shell formation in all cultured haliotids. Here we describe the analysis of 232 expressed sequence tags (EST) obtained front a developmental H. asinina cDNA library intended for future microarray studies. From this data set we identified 183 unique gene Clusters. Of these, 90 clusters showed significant homology with sequences lodged in GenBank, ranging in function from general housekeeping to signal transduction, gene regulation and cell-cell communication. Seventy-one clusters possessed completely novel ORFs greater than 50 codons in length, highlighting the paucity of sequence data from molluscs and other lophotrochozoans. This study of developmental gene expression in H. asinina provides the foundation for further detailed analyses of abalone growth, development and reproduction.
Resumo:
Craniofacial anomalies are a common feature of human congenital dysmorphology syndromes, suggesting that genes expressed in the developing face are likely to play a wider role in embryonic development. To facilitate the identification of genes involved in embryogenesis, we previously constructed an enriched cDNA library by subtracting adult mouse liver cDNA from that of embryonic day (E)10.5 mouse pharyngeal arch cDNA. From this library, 273 unique clones were sequenced and known proteins binned into functional categories in order to assess enrichment of the library (1). We have now selected 31 novel and poorly characterised genes from this library and present bioinformatic analysis to predict proteins encoded by these genes, and to detect evolutionary conservation. Of these genes 61% (19/31) showed restricted expression in the developing embryo, and a subset of these was chosen for further in silico characterisation as well as experimental determination of subcellular localisation based on transient transfection of predicted full-length coding sequences into mammalian cell lines. Where a human orthologue of these genes was detected, chromosomal localisation was determined relative to known loci for human congenital disease.
Resumo:
During early vertebrate development, the correct establishment of the body axes is critical. The anterior pole of the mouse embryo is established when Distal Visceral Endoderm (DVE) cells migrate to form the Anterior Visceral Endoderm (AVE). Symmetrical expression of Lefty1, Cer1 and Dkk1 determines the direction of DVE migration and the future anterior side. In addition to the establishment of the Anterior-Posterior axis, the AVE has also been implicated in anterior neural specification. To better understand the role of the AVE in these processes, we have performed a differential screening using Affymetrix GeneChip technology with AVE cells isolated from cer1P-EGFP transgenic mouse embryos. We found 175 genes which were upregulated in the AVE and 36 genes in the Proximal-posterior sample. Using DAVID software, we characterized the AVE cell population regarding cellular component, molecular function and biological processes. Among the genes that were found to be upregulated in the AVE, several novel genes were identified. Four of these transcripts displaying high-fold change in the AVE were further characterized by in situ hybridization in early stages of development in order to validate the screening. From those four selected genes, one, denominated Adtk1, was chosen to be functionally characterized by targeted inactivation in ES cells. Adtk1 encodes for a serine/threonine kinase. Adtk1 null mutants are smaller and present short limbs due to decreased mineralization, suggesting a potential role in chondrogenesis during limb development. Taken together, these data point to the importance of reporting novel genes present in the AVE.
Resumo:
2013
Resumo:
Dear Editor, Phytohormones are essential regulators of plant development, but their role in the signaling processes between plants and fungi during arbuscular mycorrhizal (AM) establishment is far from being understood (Ludwig-Müller, 2010). AM colonization leads to extensive effects on host metabolism, as revealed by transcriptome studies of AM plants (Hogekamp et al., 2011). Some genes have been specified as an AM core set, since they are mycorrhizal-responsive, irrespective of the identity of the plant, of the fungus, and of the investigated organ. These data support the idea that, on colonization, plants activate a wide reprogramming of their major regulatory networks and argue that mobile factors of fungal or plant origin are involved in such generalized metabolic changes. In this context, hormones may be good candidates (Bonfante and Genre, 2010). However, the emerging picture of the interaction between phytohormones and AMs is very patchy, and information on gibberellin (GA) involvement is still more limited (García-Garrido et al., 2010). The role of GA during nodulation is instead known to control the nodulation signaling pathway (Ferguson et al., 2011).
Resumo:
Tese de doutoramento, Ciências Biomédicas, Departamento de Ciências Biomédicas e Medicina, Universidade do Algarve, 2015
Resumo:
Background: Ticks secrete a cement cone composed of many salivary proteins, some of which are rich in the amino acid glycine in order to attach to their hosts' skin. Glycine-rich proteins (GRPs) are a large family of heterogeneous proteins that have different functions and features; noteworthy are their adhesive and tensile characteristics. These properties may be essential for successful attachment of the metastriate ticks to the host and the prolonged feeding necessary for engorgement. In this work, we analyzed Expressed Sequence Tags (ESTs) similar to GRPs from cDNA libraries constructed from salivary glands of adult female ticks representing three hard, metastriate species in order to verify if their expression correlated with biological differences such as the numbers of hosts ticks feed on during their parasitic life cycle, whether one (monoxenous parasite) or two or more (heteroxenous parasite), and the anatomy of their mouthparts, whether short (Brevirostrata) or long (Longirostrata). These ticks were the monoxenous Brevirostrata tick, Rhipicephalus (Boophilus) microplus, a heteroxenous Brevirostrata tick, Rhipicephalus sanguineus, and a heteroxenous Longirostrata tick, Amblyomma cajennense. To further investigate this relationship, we conducted phylogenetic analyses using sequences of GRPs from these ticks as well as from other species of Brevirostrata and Longirostrata ticks. Results: cDNA libraries from salivary glands of the monoxenous tick, R. microplus, contained more contigs of glycine-rich proteins than the two representatives of heteroxenous ticks, R. sanguineus and A. cajennense (33 versus, respectively, 16 and 11). Transcripts of ESTs encoding GRPs were significantly more numerous in the salivary glands of the two Brevirostrata species when compared to the number of transcripts in the Longirostrata tick. The salivary gland libraries from Brevirostrata ticks contained numerous contigs significantly similar to silks of true spiders (17 and 8 in, respectively, R. microplus and R. sanguineus), whereas the Longirostrata tick contained only 4 contigs. The phylogenetic analyses of GRPs from various species of ticks showed that distinct clades encoding proteins with different biochemical properties are represented among species according to their biology. Conclusions: We found that different species of ticks rely on different types and amounts of GRPs in order to attach and feed on their hosts. Metastriate ticks with short mouthparts express more transcripts of GRPs than a tick with long mouthparts and the tick that feeds on a single host during its life cycle contain a greater variety of these proteins than ticks that feed on several hosts.