950 resultados para Defence of the Realm Acts
Resumo:
SH-PTP1 (also known as PTP1C, HCP, and SHP) is a non-transmembrane protein tyrosine phosphatase (PTPase) containing two tandem Src homology 2 (SH2) domains. We show here that the two SH2 (N-SH2 and C-SH2) domains in SH-PTP1 have different functions in regulation of the PTPase domain and thereby signal transduction. While the N-terminal SH2 domain is both necessary and sufficient for autoinhibition through an intramolecular association with the PTPase domain, truncation of the C-SH2 domain [SH-PTP1 (delta CSH2) construct] has little effect on SH-PTP1 activity. A synthetic phosphotyrosine residue (pY) peptide derived from the erythropoietin receptor (EpoR pY429) binds to the N-SH2 domain and activates both wild-type SH-PTP1 and SH-PTP1 (delta CSH2) 60- to 80-fold. Another pY peptide corresponding to a phosphorylation site on the IgG Fc receptor (Fc gamma RIIB1 pY309) associates with both the C-SH2 domain (Kd = 2.8 microM and the N-SH2 domain (Kd = 15.0 microM) and also activates SH-PTP1 12-fold. By analysis of the effect of the Fc gamma RIIB1 pY309 peptide on SH-PTP1 (delta CSH2), SH-PTP1 (R30K/R33E), SH-PTP1 (R30K/R136K), and SH-PTP1 (R136K) mutants in which the function of either the N- or C-SH2 domain has been impaired, we have determined that both synthetic pY peptides stimulate SH-PTP1 by binding to its N-SH2 domain; binding of pY ligand to the C-SH2 domain has no effect on SH-PTP1 activity. We propose that the N-terminal SH2 domain serves both as a regulatory domain and as a recruiting unit, whereas the C-terminal SH2 domain acts merely as a recruiting unit.
Resumo:
The adult skeletal muscle Na+ channel mu1 possesses a highly conserved segment between subunit domains III and IV containing a consensus protein kinase C (PKC) phosphorylation site that, in the neuronal isoform, acts as a master control for "convergent" regulation by PKC and cAMP-dependent protein kinase. It lacks an approximately 200-aa segment between domains I and II though to modulate channel gating. We here demonstrate that mu1 is regulated by PKC (but not cAMP-dependent protein kinase) in a manner distinct from that observed for the neuronal isoforms, suggesting that under the same conditions muscle excitation could be uncoupled from motor neuron input. Maximal phosphorylation by PKC, in the presence of phosphatase inhibitors, reduced peak Na+ currents by approximately 90% by decreasing the maximal conductance, caused a -15 mV shift in the midpoint of steady-state inactivation, and caused a slight speeding of inactivation. Surprisingly, these effects were not affected by mutation of the conserved serine (serine-1321) in the interdomain III-IV loop. the pattern of current suppression and gating modification by PKC resembles the response of muscle Na+ channels to inhibitory factors present in the serum and cerebrospinal fluid of patients with Guillain-Barré syndrome, multiple sclerosis, and idiopathic demyelinating polyradiculoneuritis.
Resumo:
The extensive refolding of the membrane-anchoring chain of hemagglutinin (HA) of influenza virus (termed HA2) in cellular endosomes, which initiates viral entry by membrane fusion, suggests that viral HA is meta-stable. HA2 polypeptide residues 38-175 expressed in Escherichia coli are reported here to fold in vivo into a soluble trimer. The structure appears to be the same as the low-pH-induced conformation of viral HA2 by alpha-helical content, thermodynamic stability, protease dissection, electron microscopy, and antibody binding. These results provide evidence that the structure of the low-pH-induced fold of viral HA2 (TBHA2) observed crystallographically is the lowest-energy-state fold of the HA2 polypeptide. They indicate that the HA2 conformation in viral HA before low pH activation of its fusion potential is metastable and suggest that removal of the receptor-binding chain (HA1) is enough to allow HA2 to adopt the stable state. Further, they provide direct evidence that low pH is not required to form the membrane-fusion conformation but acts to make this state kinetically accessible in viral HA.
Resumo:
Integration of human immunodeficiency virus (HIV) DNA into the human genome requires the virus-encoded integrase (IN) protein, and therefore the IN protein is a suitable target for antiviral strategies. To find a potent HIV IN inhibitor, we screened a "synthetic peptide combinatorial library." We identified a hexapeptide with the sequence HCKFWW that inhibits IN-mediated 3'-processing and integration with an IC50 of 2 microM. The peptide is active on IN proteins from other retroviruses such as HIV-2, feline immunodeficiency virus, and Moloney murine leukemia virus, supporting the notion that a conserved region of IN is targeted. The hexapeptide was also tested in the disintegration reaction. This phosphoryl-transfer reaction can be carried out by the catalytic core of IN alone, and the peptide HCKFWW was found to inhibit this reaction, suggesting that the hexapeptide acts at or near the catalytic site of IN. Identification of an IN hexapeptide inhibitor provides proof of concept for the approach, and, moreover, this peptide may be useful for structure-function analysis of IN.
Resumo:
Previous research indicates that norepinephrine and dopamine stimulate release of luteinizing hormone (LH)-releasing hormone (LHRH), which then reaches the adenohypophysis via the hypophyseal portal vessels to release LH. Norepinephrine exerts its effect via alpha 1-adrenergic receptors, which stimulate the release of nitric oxide (NO) from nitricoxidergic (NOergic) neurons in the medial basal hypothalamus (MBH). The NO activates guanylate cyclase and cyclooxygenase, thereby inducing release of LHRH into the hypophyseal portal vessels. We tested the hypothesis that these two catecholamines modulate NO release by local feedback. MBH explants were incubated in the presence of sodium nitroprusside (NP), a releaser of NO, and the effect on release of catecholamines was determined. NP inhibited release of norepinephrine. Basal release was increased by incubation of the tissue with the NO scavenger hemoglobin (20 micrograms/ml). Hemoglobin also blocked the inhibitory effect of NP. In the presence of high-potassium (40 mM) medium to depolarize cell membranes, norepinephrine release was increased by a factor of 3, and this was significantly inhibited by NP. Hemoglobin again produced a further increase in norepinephrine release and also blocked the action of NP. When constitutive NO synthase was inhibited by the competitive inhibitor NG-monomethyl-L-arginine (NMMA) at 300 microM, basal release of norepinephrine was increased, as was potassium-evoked release, and this was associated in the latter instance with a decrease in tissue concentration, presumably because synthesis did not keep up with the increased release in the presence of NMMA. The results were very similar with dopamine, except that reduction of potassium-evoked dopamine release by NP was not significant. However, the increase following incubation with hemoglobin was significant, and hemoglobin, when incubated with NP, caused a significant elevation in dopamine release above that with NP alone. In this case, NP increased tissue concentration of dopamine along with inhibiting release, suggesting that synthesis continued, thereby raising the tissue concentration in the face of diminished release. When the tissue was incubated with NP plus hemoglobin, which caused an increase in release above that obtained with NP alone, the tissue concentration decreased significantly compared with that in the absence of hemoglobin, indicating that, with increased release, release exceeded synthesis, causing a fall in tissue concentration. When NO synthase was blocked by NMMA, the release of dopamine, under either basal or potassium-evoked conditions, was increased. Again, in the latter instance the tissue concentration declined significantly, presumably because synthesis did not match release. Therefore, the results were very similar with both catecholamines and indicate that NO acts to suppress release of both amines. Since both catecholamines activate the release of LHRH, the inhibition of their release by NO serves as an ultra-short-loop negative feedback by which NO inhibits the release of the catecholamines, thereby reducing the activation of the NOergic neurons and decreasing the release of LHRH. This may be an important means for terminating the pulses of release of LHRH, which generate the pulsatile release of LH that stimulates gonadal function in both male and female mammals.
Resumo:
The IFNAR chain of the type I interferon (IFN) receptor (IFNIR) undergoes rapid ligand-dependent tyrosine phosphorylation and acts as a species-specific transducer for type I IFN action. Using the vaccinia/T7 expression system to amplify IFNAR expression, we found that human HeLa-S3 cells transiently express high levels of cell surface IFNAR chains (approximately 250,000 chains per cell). Metabolic labeling and immunoblot analysis of transfected HeLa cells show that the IFNAR chain is initially detected as 65-kDa and 98-kDa precursors, and then as the 130-kDa mature protein. Due to variation in N-glycosylation, the apparent molecular mass of the mature IFNAR chain varies from 105 to 135 kDa in different cells. IFNIR structure was characterized in various human cell lines by analyzing 125I-labeled IFN cross-linked complexes recognized by various antibodies against IFNIR subunits and JAK protein-tyrosine kinases. Precipitation of cross-linked material from Daudi cells with anti-IFNAR antibodies showed that IFNAR was present in a 240-kDa complex. Precipitation of cross-linked material from U937 cells with anti-TYK2 sera revealed a 240-kDa complex, which apparently did not contain IFNAR and was not present in IFN-resistant HEC1B cells. The tyrosine phosphorylation and down-regulation of the IFNAR chain were induced by type I IFN in several human cell lines of diverse origins but not in HEC1B cells. However, of type I IFNs, IFN-beta uniquely induced the tyrosine phosphorylation of a 105-kDa protein associated with the IFNAR chain in two lymphoblastoid cell lines (Daudi and U266), demonstrating the specificity of transmembrane signaling for IFN-beta and IFN-alpha through the IFNAR chain.
Resumo:
Platelet factor 4 (PF-4) is an archetype of the "chemokine" family of low molecular weight proteins that play an important role in injury responses and inflammation. From activated human leukocyte culture supernatants, we have isolated a form of PF-4 that acts as a potent inhibitor of endothelial cell proliferation. The PF-4 derivative is generated by peptide bond cleavage between Thr-16 and Ser-17, a site located downstream from the highly conserved and structurally important CXC motif. The unique cleavage leads to a loss of one of the structurally important large loops in the PF-4 molecule and generation of an N terminus with basic residues that have the potential to interact with the acidic extracellular domain of the G-protein-coupled chemokine receptor. The N-terminal processed PF-4 exhibited a 30- to 50-fold greater growth inhibitory activity on endothelial cells than PF-4. Since endothelial cell growth inhibition is the only known cellular activity of the cleaved PF-4, we have designated this chemokine endothelial cell growth inhibitor. The N-terminal processing of PF-4 may represent an important mechanism for modulating PF-4 activity on endothelial cells during tissue injury, inflammation, and neoplasia.
Resumo:
The transforming growth factors beta (TGF-beta s) are important modulators of growth and differentiation. They are intermolecular disulfide-bonded homodimeric molecules. The monomer fold has a conserved cystine knot and lacks a hydrophobic core. The biological specificity of a given member of the family is believed to be determined by the conformational flexibility of the variable loop regions of the monomer. The monomer subunit assembly in the dimer is stabilized mainly by hydrophobic contacts and a few hydrogen bonds. Since these interactions are nondirectional, we examined subunit assemblies of TGF-beta by using conformational analysis. The different subunit assemblies in TGF-beta 2 dimer were characterized in terms of the intersubunit disulfide torsion. Our analyses show that the subunit assemblies fall into two states: the crystallographically observed gauche+conformation and the previously not reported gauche--conformation, both having almost identical interaction energies. Furthermore, there is significant flexibility in the subunit assembly within the gauche+ and the gauche- states of the disulfide bond. The monomer subunit assembly is independent of the variations about the loop regions. The variations in the loop regions, coupled with flexibility in the monomer assembly, lead to a complex flexibility in the dimer of the TGF-beta superfamily. For the TGF-beta superfamily, the cystine knot acts as a scaffold and complex flexibility provides for biological selectivity. Complex flexibility might provide an explanation for the diverse range of biological activities that these important molecules display.
Resumo:
Plakoglobin interacts with both classical and desmosomal cadherins. It is closely related to Drosophila aramadillo (arm) gene product; arm acts in the wingless (wg)-signaling pathway to establish segment polarity. In Xenopus, homologs of wg--i.e., wnts, can produce anterior axis duplications by inducing dorsal mesoderm. Studies in Drosophila suggest that wnt acts by increasing the level of cytoplasmic armadillo protein (arm). To test whether simply increasing the level of plakoglobin mimics the effects of exogenous wnts in Xenopus, we injected fertilized eggs with RNA encoding an epitope-tagged form of plakoglobin; this induced both early radial gastrulation and anterior axis duplication. Exogenous plakoglobin accumulates in the nuclei of embryonic cells. Plakoglobin binds to the tail domain of the desmosomal cadherin desmoglein 1. When RNA encoding the tail domain of desmoglein was coinjected with plakoglobin RNA, both the dorsalizing effect and nuclear accumulation of plakoglobin were suppressed. Mutational analysis indicates that the central arm repeat region of plakoglobin is sufficient to induce axis duplication and that this polypeptide accumulates in the nuclei of embryonic cells. These data show that increased plakoglobin levels can, by themselves, generate the intracellular signals involved in the specification of dorsal mesoderm.
Resumo:
Plasmid-encoded addiction genes augment the apparent stability of various low copy number bacterial plasmids by selectively killing plasmid-free (cured) segregants or their progeny. The addiction module of plasmid prophage P1 consists of a pair of genes called phd and doc. Phd serves to prevent host death when the prophage is retained and, should retention mechanisms fail, Doc causes death on curing. Doc acts as a cell toxin to which Phd is an antidote. In this study we show that host mutants with defects in either subunit of the ClpXP protease survive the loss of a plasmid that contains a P1 addiction module. The small antidote protein Phd is fully stable in these two mutant hosts, whereas it is labile in a wild-type host. We conclude that the role of ClpXP in the addiction mechanism of P1 is to degrade the Phd protein. This conclusion situates P1 among plasmids that elicit severe withdrawal symptoms and are able to do so because they encode both a cell toxin and an actively degraded macromolecule that blocks the synthesis or function of the toxin.
Resumo:
Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.
Resumo:
Data from the HEGRA air shower array are used to set an upper limit on the emission of gamma-radiation above 25 (18) TeV from the direction of the radio bright region DR4 within the SNR G78.2 + 2.1 of 2.5 (7.1). 10^-13 cm^-2 sec^-1. The shock front of SNR G78.2 + 2.1 probably recently overtook the molecular cloud Gong 8 which then acts as a target for the cosmic rays produced within the SNR, thus leading to the expectation of enhanced gamma-radiation. Using a model of Drury, Aharonian and Völk which assumes that SNRs are the sources of galactic cosmic rays via first order Fermi acceleration, we calculated a theoretical prediction for the gamma-ray flux from the DR4 region and compared it with our experimental flux limit. Our 'best estimate' value for the predicted flux lies a factor of about 18 above the upper limit for gamma-ray energies above 25 TeV. Possible reasons for this discrepancy are discussed.
Resumo:
This article advocates for a fundamental re-understanding about the way that the history of race is understood by the current Supreme Court. Represented by the racial rights opinions of Justice John Roberts that celebrate racial progress, the Supreme Court has equivocated and rendered obsolete the historical experiences of people of color in the United States. This jurisprudence has in turn reified the notion of color-blindness, consigning racial discrimination to a distant and discredited past that has little bearing to how race and inequality is experienced today. The racial history of the Roberts Court is centrally informed by the context and circumstances surrounding Brown v. Board of Education. For the Court, Brown symbolizes all that is wrong with the history of race in the United States - legal segregation, explicit racial discord, and vicious and random acts of violence. Though Roberts Court opinions suggest that some of those vestiges still exits, the bulk of its jurisprudence indicate the opposite. With Brown’s basic factual premises as its point of reference, the Court has consistently argued that the nation has made tremendous strides away from the condition of racial bigotry, intolerance, and inequity. The article accordingly argues that the Roberts Court reliance on Brown to understand racial progress is anachronistic. Especially as the nation’s focus for racial inequality turned national in scope, the same binaries in Brown that had long served to explain the history of race relations in the United States (such as Black-White, North-South, and Urban-Rural) were giving way to massive multicultural demographic and geographic transformations in the United States in the years and decades after World War II. All of the familiar tropes so clear in Brown and its progeny could no longer fully describe the current reality of shifting and transforming patterns of race relations in the United States. In order to reclaim the history of race from the Roberts Court, the article assesses a case that more accurately symbolizes the recent history and current status of race relations today: Keyes v. School District No. 1. This was the first Supreme Court case to confront how the binaries of cases like Brown proved of little probative value in addressing how and in what ways race and racial discrimination was changing in the United States. Thus, understanding Keyesand the history it reflects reveals much about how and in what ways the Roberts Court should rethink its conclusions regarding the history of race relations in the United States for the last 60 years.
Resumo:
This capstone examines the civil liberties of the modern terrorist and explicates the right to freedom of speech for terrorist organizations and their use of the internet. Terrorist organizations use the internet to promote ideas, recruit members, organize the flow of information, and coordinate actions. During the war on terror the US Patriot Act became law allowing for U.S. government censorship and surveillance of internet traffic and many believe these acts are a threat to civil liberties. Terrorist organizations have the right to express their views, however unpopular, and censoring or restricting web sites diminishes civil liberties for all, which democracies and liberal societies are founded upon.
Resumo:
Interdisciplinary studies combining field data (geological and tectonic mapping, lithostratigraphic reconstructions, lithofacies characterization, correlations and sampling) and laboratory analyses (biostratigraphy, chronostratigraphy, clay mineralogy and sandstone petrography) of eight Senonian-Paleogene successions from the Sierra de La Pila and Sierra de El Carche areas (Murcia province, SE Spain) belonging to the External Betic Zone are presented. Field evidence of tectonic activity (slumps, olistostromes, syn-genetic folds, lateral variability, changes in thicknesses, para- and unconformity boundaries, stratigraphic gaps, shallowing upward trends to emersion, etc.) was found in several Paleogene intervals. The results enable a better reconstruction of the stratigraphic architecture and chronostratigraphy of the Paleogene record, highlighting in particular: facies evolution, discontinuities, depositional sequences (Middle-Upper Maastrichtian, Upper Paleocene-Middle Eocene, Oligocene-Lower Aquitanian), environmental evolution (homogeneous conditions during the Late Cretaceous and successive realm diversification from platform to slope to basin) and correlations, along the Prebetic to Subbetic transition, which is a key sector to understand the northeastward variations of the South Iberian margin. A conclusive paleogeographic and geodynamic evolutionary model for the study area is proposed, hypothesizing that Paleogene compressive tectonics affected the eastern External Betic Zone. In addition, correlations with successions from the western External Betic Zone evidenced asynchronous deformation from east to west along the internalmost External Betic Zone. Moreover, a comparison with the external Tunisian Tell enables the recognition of similar sedimentarytectonic events, imposing new constraints in the Paleogene geodynamic reconstruction throughout the western Tethys.