958 resultados para Classical orthogonal polynomials of a discrete variable


Relevância:

100.00% 100.00%

Publicador:

Resumo:

O presente artigo discute alguns aspectos da relação entre biológico e social, tomando por objeto o campo da Saúde Coletiva no Brasil e o campo das Ciências Sociais, mais especificamente a sociologia. Parte-se do pressuposto de que o conceito que norteia o campo da Saúde Coletiva, o da determinação social (formulado em meados dos anos 1970 e 1980), foi profundamente marcado por certa leitura do social, impregnada dos marcos teóricos clássicos das ciências sociais e marcada pelo cenário político-institucional em que os campos - da Saúde Coletiva e das Ciências Sociais - encontravam-se historicamente. O objetivo é discutir o esgotamento dessa formulação teórica tendo em vista o cenário das profundas mudanças ocorridas nas sociedades contemporâneas em sua etapa industrial tardia, pós-industrial ou tardo-moderna. Acredita-se que a discussão sobre os marcos teóricos constitutivos do campo da Saúde Coletiva contribuirá para um enfrentamento das questões de saúde mais consoante com as mudanças sociais ocorridas.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

We propose a statistical model to account for the gel-fluid anomalous phase transitions in charged bilayer- or lamellae-forming ionic lipids. The model Hamiltonian comprises effective attractive interactions to describe neutral-lipid membranes as well as the effect of electrostatic repulsions of the discrete ionic charges on the lipid headgroups. The latter can be counterion dissociated (charged) or counterion associated (neutral), while the lipid acyl chains may be in gel (low-temperature or high-lateral-pressure) or fluid (high-temperature or low-lateral-pressure) states. The system is modeled as a lattice gas with two distinct particle types-each one associated, respectively, with the polar-headgroup and the acyl-chain states-which can be mapped onto an Ashkin-Teller model with the inclusion of cubic terms. The model displays a rich thermodynamic behavior in terms of the chemical potential of counterions (related to added salt concentration) and lateral pressure. In particular, we show the existence of semidissociated thermodynamic phases related to the onset of charge order in the system. This type of order stems from spatially ordered counterion association to the lipid headgroups, in which charged and neutral lipids alternate in a checkerboard-like order. Within the mean-field approximation, we predict that the acyl-chain order-disorder transition is discontinuous, with the first-order line ending at a critical point, as in the neutral case. Moreover, the charge order gives rise to continuous transitions, with the associated second-order lines joining the aforementioned first-order line at critical end points. We explore the thermodynamic behavior of some physical quantities, like the specific heat at constant lateral pressure and the degree of ionization, associated with the fraction of charged lipid headgroups.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

We investigate the performance of a variant of Axelrod's model for dissemination of culture-the Adaptive Culture Heuristic (ACH)-on solving an NP-Complete optimization problem, namely, the classification of binary input patterns of size F by a Boolean Binary Perceptron. In this heuristic, N agents, characterized by binary strings of length F which represent possible solutions to the optimization problem, are fixed at the sites of a square lattice and interact with their nearest neighbors only. The interactions are such that the agents' strings (or cultures) become more similar to the low-cost strings of their neighbors resulting in the dissemination of these strings across the lattice. Eventually the dynamics freezes into a homogeneous absorbing configuration in which all agents exhibit identical solutions to the optimization problem. We find through extensive simulations that the probability of finding the optimal solution is a function of the reduced variable F/N(1/4) so that the number of agents must increase with the fourth power of the problem size, N proportional to F(4), to guarantee a fixed probability of success. In this case, we find that the relaxation time to reach an absorbing configuration scales with F(6) which can be interpreted as the overall computational cost of the ACH to find an optimal set of weights for a Boolean binary perceptron, given a fixed probability of success.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

No-till (NT) adoption is an essential tool for development of sustainable agricultural systems, and how NT affects the soil organic C (SOC) dynamics is a key component of these systems. The effect of a plow tillage (PT) and NT age chronosequence on SOC concentration and interactions with soil fertility were assessed in a variable charge Oxisol, located in the South Center quadrant of Parana State, Brazil (50 degrees 23`W and 24 degrees 36`S). The chronosequence consisted of the following six sites: (i) native field (NF); (ii) PT of the native field (PNF-1) involving conversion of natural vegetation to cropland; (iii) NT for 10 years (NT-10); (iv) NT for 20 years (NT-20); (v) NT for 22 years (NT-22); and (vi) conventional tillage for 22 years (CT-22) involving PT with one disking after summer harvest and one after winter harvest to 20 cm depth plus two harrow disking. Soil samples were collected from five depths (0-2.5; 2.5-5; 5-10; 10-20; and 20-40 cm) and SOC, pH (in H(2)O and KCl), Delta pH, potential acidity, exchangeable bases, and cation exchangeable capacity (CEC) were measured. An increase in SOC concentration positively affected the pH, the negative charge and the CEC and negatively impacted potential acidity. Regression analyses indicated a close relationship between the SOC concentration and other parameters measured in this study. The regression fitted between SOC concentration and CEC showed a close relationship. There was an increase in negative charge and CEC with increase in SOC concentration: CEC increased by 0.37 cmol(c) kg(-1) for every g of C kg(-1) soil. The ratio of ECEC:SOC was 0.23 cmol(c) kg(-1) for NF and increased to 0.49 cmol(c) kg(-1) for NT-22. The rates of P and K for 0-10 cm depth increased by 9.66 kg ha(-1) yr(-1) and 17.93 kg ha(-1) yr(-1), respectively, with NF as a base line. The data presented support the conclusion that long-term NT is a useful strategy for improving fertility of soils with variable charge. (C) 2008 Elsevier B.V. All rights reserved.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

This paper presents an Adaptive Maximum Entropy (AME) approach for modeling biological species. The Maximum Entropy algorithm (MaxEnt) is one of the most used methods in modeling biological species geographical distribution. The approach presented here is an alternative to the classical algorithm. Instead of using the same set features in the training, the AME approach tries to insert or to remove a single feature at each iteration. The aim is to reach the convergence faster without affect the performance of the generated models. The preliminary experiments were well performed. They showed an increasing on performance both in accuracy and in execution time. Comparisons with other algorithms are beyond the scope of this paper. Some important researches are proposed as future works.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

In Part I [""Fast Transforms for Acoustic Imaging-Part I: Theory,"" IEEE TRANSACTIONS ON IMAGE PROCESSING], we introduced the Kronecker array transform (KAT), a fast transform for imaging with separable arrays. Given a source distribution, the KAT produces the spectral matrix which would be measured by a separable sensor array. In Part II, we establish connections between the KAT, beamforming and 2-D convolutions, and show how these results can be used to accelerate classical and state of the art array imaging algorithms. We also propose using the KAT to accelerate general purpose regularized least-squares solvers. Using this approach, we avoid ill-conditioned deconvolution steps and obtain more accurate reconstructions than previously possible, while maintaining low computational costs. We also show how the KAT performs when imaging near-field source distributions, and illustrate the trade-off between accuracy and computational complexity. Finally, we show that separable designs can deliver accuracy competitive with multi-arm logarithmic spiral geometries, while having the computational advantages of the KAT.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

A general, fast wavelet-based adaptive collocation method is formulated for heat and mass transfer problems involving a steep moving profile of the dependent variable. The technique of grid adaptation is based on sparse point representation (SPR). The method is applied and tested for the case of a gas–solid non-catalytic reaction in a porous solid at high Thiele modulus. Accurate and convergent steep profiles are obtained for Thiele modulus as large as 100 for the case of slab and found to match the analytical solution.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

In quantum measurement theory it is necessary to show how a, quantum source conditions a classical stochastic record of measured results. We discuss mesoscopic conductance using quantum stochastic calculus to elucidate the quantum nature of the measurement taking place in these systems. To illustrate the method we derive the current fluctuations in a two terminal mesoscopic circuit with two tunnel barriers containing a single quasi bound state on the well. The method enables us to focus on either the incoming/ outgoing Fermi fields in the leads, or on the irreversible dynamics of the well state itself. We show an equivalence between the approach of Buttiker and the Fermi quantum stochastic calculus for mesoscopic systems.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The literature examining purported relationships between ownership of companion animals and health is extremely heterogeneous. While much of the descriptive literature tends to support benefits of animal companionship, large scale, controlled research yields inconsistent and even contradictory findings on several issues, including associations with cardiovascular disease, mood and wellbeing. In an analysis of a large longitudinal data-set from the Australian Longitudinal Study on Women's Health, a prospective study of a nationally representative sample of more than 12,000 older women, difficulties with disentangling the effects of powerful demographic variables and age-related factors from the specific effects of pet ownership became apparent. Both cross-sectional and longitudinal analyses demonstrated that associations between mental and physical health and pet ownership as well as changes in pet ownership over time were weak and inconsistent compared to the large effects of living arrangements and other demographic variables. As sociodemographic variables relate strongly to both health and opportunities for pet ownership, this high level of confounding means it is unlikely that the impact of the specific variable of pet ownership on health can be ascertained from such studies. Rather, well-designed experimental studies, wherein the majority of such confounding variables can be held constant or at least somewhat controlled, are needed.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

100.00% 100.00%

Publicador:

Resumo:

A continuum model for regular block structures is derived by replacing the difference quotients of the discrete equations by corresponding differential quotients. The homogenization procedure leads to an anisotropic Cosserat Continuum. For elastic block interactions the dispersion relations of the discrete and the continuous models are derived and compared. Yield criteria for block tilting and sliding are formulated. An extension of the theory for large deformation is proposed. (C) 1997 by John Wiley & Sons, Ltd.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Purpose: To evaluate the ability of the GDx Variable Corneal Compensation (VCC) Guided Progression Analysis (GPA) software for detecting glaucomatous progression. Design: Observational cohort study. Participants: The study included 453 eyes from 252 individuals followed for an average of 46 +/- 14 months as part of the Diagnostic Innovations in Glaucoma Study. At baseline, 29% of the eyes were classified as glaucomatous, 67% of the eyes were classified as suspects, and 5% of the eyes were classified as healthy. Methods: Images were obtained annually with the GDx VCC and analyzed for progression using the Fast Mode of the GDx GPA software. Progression using conventional methods was determined by the GPA software for standard automated achromatic perimetry (SAP) and by masked assessment of optic disc stereophotographs by expert graders. Main Outcome Measures: Sensitivity, specificity, and likelihood ratios (LRs) for detection of glaucoma progression using the GDx GPA were calculated with SAP and optic disc stereophotographs used as reference standards. Agreement among the different methods was reported using the AC(1) coefficient. Results: Thirty-four of the 431 glaucoma and glaucoma suspect eyes (8%) showed progression by SAP or optic disc stereophotographs. The GDx GPA detected 17 of these eyes for a sensitivity of 50%. Fourteen eyes showed progression only by the GDx GPA with a specificity of 96%. Positive and negative LRs were 12.5 and 0.5, respectively. None of the healthy eyes showed progression by the GDx GPA, with a specificity of 100% in this group. Inter-method agreement (AC1 coefficient and 95% confidence intervals) for non-progressing and progressing eyes was 0.96 (0.94-0.97) and 0.44 (0.28-0.61), respectively. Conclusions: The GDx GPA detected glaucoma progression in a significant number of cases showing progression by conventional methods, with high specificity and high positive LRs. Estimates of the accuracy for detecting progression suggest that the GDx GPA could be used to complement clinical evaluation in the detection of longitudinal change in glaucoma. Financial Disclosure(s): Proprietary or commercial disclosure may be found after the references. Ophthalmology 2010; 117: 462-470 (C) 2010 by the American Academy of Ophthalmology.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Whenever the surgeon uses the stomach as an esophageal substitute, either one of two techniques is generally performed: total gastric transposition or gastric tube esophagoplasty. No existing reports compare the complications associated with these two surgical procedures. The purpose of this study is to review the authors` experience with total gastric transposition and verify whether this technique is superior to gastric tube esophagoplasty in children by comparing the main complications with those reported in the publications of gastric tubes esophagoplasties in the English language literature published in the last 38 years. A total of 35 children underwent total gastric transposition according to the classical technique. Most of these patients (27, or 77.1%) had long gap esophageal atresia. The most frequently observed complications were compared to those reported in nine studies of gastric tube esophagoplasty comprising 184 patients. Mortality and graft failure rates were also compared. Seven patients (20.0%) presented with leaks, all of which closed spontaneously. Six children were reoperated, three experienced gastric outlet obstruction secondary to axial torsion of the stomach placed in the retrosternal space and the other three experienced delayed gastric emptying that required revision of the piloroplasty. There were two deaths (5.7%) and no graft failure. Strictures were observed in five patients (14.2%) and all of these were resolved with endoscopic dilatations. Six patients had diarrhea that spontaneously resolved. In the late follow-up period, all patients were on full feed and thriving well. The comparisons with gastric tube patients demonstrated that the total gastric transposition group presented with significantly less leaks and strictures (P = 0.0001 and 0.001, respectively). The incidence of death and graft failure was not statistically different. In conclusion, gastric transposition is as a simple technical procedure for esophageal replacement in children with satisfactory results, and is superior to gastric tube esophagoplasty.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

We demonstrate that a system obeying the complex Lorenz equations in the deep chaotic regime can be controlled to periodic behavior by applying a modulation to the pump parameter. For arbitrary modulation frequency and amplitude there is no obvious simplification of the dynamics. However, we find that there are numerous windows where the chaotic system has been controlled to different periodic behaviors. The widths of these windows in parameter space are narrow, and the positions are related to the ratio of the modulation frequency of the pump to the average pulsation frequency of the output variable. These results are in good agreement with observations previously made in a far-infrared laser system.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

We study the continuous problem y"=f(x,y,y'), xc[0,1], 0=G((y(0),y(1)),(y'(0), y'(1))), and its discrete approximation (y(k+1)-2y(k)+y(k-1))/h(2) =f(t(k), y(k), v(k)), k = 1,..., n-1, 0 = G((y(0), y(n)), (v(1), v(n))), where f and G = (g(0), g(1)) are continuous and fully nonlinear, h = 1/n, v(k) = (y(k) - y(k-1))/h, for k =1,..., n, and t(k) = kh, for k = 0,...,n. We assume there exist strict lower and strict upper solutions and impose additional conditions on f and G which are known to yield a priori bounds on, and to guarantee the existence of solutions of the continuous problem. We show that the discrete approximation also has solutions which approximate solutions of the continuous problem and converge to the solution of the continuous problem when it is unique, as the grid size goes to 0. Homotopy methods can be used to compute the solution of the discrete approximation. Our results were motivated by those of Gaines.