Retrospective canine skin peripheral nerve sheath tumors data with emphasis on histologic, immunohistochemical and prognostic factors

Abstract: In this retrospective study was determined the frequency of canine skin peripheral nerve sheath tumors (PNST) in cases diagnosed by the Setor de Patologia Veterinária of the Universidade Federal do Rio Grande do Sul (SPV-UFRGS), Brazil, between the years 2000 and 2012. The canine profiles, as well as histological, immunohistochemical and prognostic aspects of the tumors were based on 70 samples, comprising 40 females, 29 males and one unspecified sample. Between 2000 and 2012, 2,984 skin tumors of dogs were diagnosed in the SPV-UFRGS, totaling 2.34% of skin neoplasms in dogs. Animals that comprised the largest amount of samples (43%) were those with no breed (SRD), followed by German Shepherds (10%). Females were more affected than males (40/70 - 57% and 29/70 - 41% respectively). Skin PNST of this research showed predominant localization on the limbs (40% in the forelimbs and 29% in the hindlimbs); affecting adult dogs, mostly aged between 8 and 11 years (54%). The samples were routinely processed for hematoxylin and eosin, and were also evaluated by toluidine blue and Masson's trichrome staining, and immunohistochemistry (IHC) anti-vimentin, -S-100, -GFAP, -actin, von Willebrand factor and neurofilament. Anisocytosis and anisokaryosis, mitotic index, intratumoral necrosis, invasion of adjacent tissues, tumor location, local recurrence and metastasis were related to the diagnosis of benign (49/70) or malignant tumor (21/70). The Antoni A histological pattern was observed more frequently in benign tumors. The immunohistochemistry helped to diagnose PNST, and anti-vimentin and anti-protein S-100 showed the highest rates of immunostaining. Throughout statistical analysis of animals with tumor recurrence, it was found that the chance of an animal with a malignant peripheral nerve sheath tumor to develop recurrence is 4.61 times higher than in an animal that had a benign tumor.

Trisomy 13 mosaicism demonstrated only in skin fibroblasts in a patient presenting psychomotor retardation, pigmentary dysplasia and some dysmorphic features

A Brazilian female infant presented delayed psychomotor development, skin pigmentary dysplasia and some dysmorphic features. Chromosome analysis from peripheral blood culture was normal, but the karyotype from skin fibroblasts revealed mosaicism for trisomy 13. This case demonstrates the relevance of performing chromosomal analysis of skin fibroblasts in patients with mental retardation, associated with pigmentary dysplasia of the skin and a normal karyotype in peripheral blood lymphocytes. To our knowledge, it is the first report of trisomy 13 demonstrated only in skin fibroblasts.

Fast and slow voltage modulation of apical Cl- permeability in toad skin at high [K+]

The influence of voltage on the conductance of toad skin was studied to identify the time course of the activation/deactivation dynamics of voltage-dependent Cl- channels located in the apical membrane of mitochondrion-rich cells in this tissue. Positive apical voltage induced an important conductance inhibition which took a few seconds to fully develop and was instantaneously released by pulse inversion to negative voltage, indicating a short-duration memory of the inhibiting factors. Sinusoidal stimulation at 23.4 mM [Cl-] showed hysteresis in the current versus voltage curves, even at very low frequency, suggesting that the rate of voltage application was also relevant for the inhibition/releasing effect to develop. We conclude that the voltage modulation of apical Cl- permeability is essentially a fast process and the apparent slow components of activation/deactivation obtained in the whole skin are a consequence of a gradual voltage build-up across the apical membrane due to voltage sharing between apical and basolateral membranes

Angiotensin-(1-7) increases osmotic water permeability in isolated toad skin

Angiotensin-(1-7) (Ang-(1-7)) increased osmotic water permeability in the isolated toad skin, a tissue with functional properties similar to those of the distal mammalian nephron. Concentrations of 0.1 to 10 µM were effective, with a peak at 20 min. This effect was similar in magnitude to that of frog skin angiotensin II (Ang II) and oxytocin but lower than that of human Ang II and arginine-vasotocin. The AT2 angiotensin receptor antagonist PD 123319 (1.0 µM) fully inhibited the response to 0.1 µM Ang-(1-7) but had no effect on the response to Ang II at the same concentration. The specific receptor antagonist of Ang-(1-7), A-779, was ineffective in blocking the response to Ang-(1-7) and to frog skin Ang II. The AT1 receptor subtype antagonist losartan, which blocked the response to frog skin Ang II, was ineffective in blocking the response to Ang-(1-7). The present results support the view of an antidiuretic action of Ang-(1-7) in the mammalian nephron.

No evidence for mutations in exons 1, 8 and 18 of the patched gene in sporadic skin lesions of Brazilian patients

There is strong evidence that the patched (PTCH) gene is a gene for susceptibility to the nevoid basal cell carcinoma syndrome. PTCH has also been shown to mutate in both familial and sporadic basal cell carcinomas. However, mutations of the gene seem to be rare in squamous cell carcinomas. In order to characterize the role of the gene in the broader spectrum of sporadic skin malignant and pre-malignant lesions, we performed a polymerase chain reaction-single-strand conformation polymorphism (PCR-SSCP) analysis of genomic DNA extracted from 105 adult patients (46 females and 59 males). There were 66 patients with basal cell carcinomas, 30 with squamous cell carcinomas, 2 with malignant melanomas and 7 patients with precancerous lesions. Two tissue samples were collected from each patient, one from the central portion of the tumor and another from normal skin. Using primers that encompass the entire exon 1, exon 8 and exon 18, where most of the mutations have been detected, we were unable to demonstrate any band shift. Three samples suspected to present aberrant migrating bands were excised from the gel and sequenced directly. In addition, we sequenced 12 other cases, including tumors and corresponding normal samples. A wild-type sequence was found in all 15 cases. Although our results do not exclude the presence of clonal alterations of the PTCH gene in skin cancers or mutations in other exons that were not screened, the present data do not support the presence of frequent mutations reported for non-melanoma skin cancer of other populations.

Skin secretion of Siphonops paulensis (Gymnophiona, Amphibia) forms voltage-dependent ionic channels in lipid membranes

The effect of the skin secretion of the amphibian Siphonops paulensis was investigated by monitoring the changes in conductance of an artificial planar lipid bilayer. Skin secretion was obtained by exposure of the animals to ether-saturated air, and then rinsing the animals with distilled water. Artificial lipid bilayers were obtained by spreading a solution of azolectin over an aperture of a Delrin cup inserted into a cut-away polyvinyl chloride block. In 9 of 12 experiments, the addition of the skin secretion to lipid bilayers displayed voltage-dependent channels with average unitary conductance of 258 ± 41.67 pS, rather than nonspecific changes in bilayer conductance. These channels were not sensitive to 4-acetamido-4'-isothiocyanatostilbene-2,2'-disulfonic acid or tetraethylammonium ion, but the experimental protocol used does not permit us to specify their characteristics.

Normal skin of HIV-infected individuals contains increased numbers of dermal CD8 T cells and normal numbers of Langerhans cells

Dysregulation of the skin immune system (SIS) could explain the high prevalence of skin disorders in HIV+ individuals. The present study was carried out to determine whether alterations in the cell population of SIS and epidermal immunoactivation occur in the normal skin of HIV+ individuals. Forty-five biopsies were taken from the normal upper arm skin of 45 HIV+ patients and of 15 healthy controls. HIV+ individuals were divided into three categories according to their CD4 cell blood count (<200, 200-499 and ³500/µl). Hematoxylin-eosin was used to stain tissue sections for morphological analysis and immunohistochemistry was used for the evaluation of the frequency of macrophages, Langerhans cells, and CD lymphocyte subsets. In addition, semiquantitative analysis of LFA-1, ICAM-1 and HLA-DR was determined in epidermal cells. Macrophages, Langerhans cells, and CD lymphocyte subsets did not differ significantly between any of the patient categories and the control group. When all HIV+ individuals were compared as a group to the control group, a significant increase in dermal CD8+ T lymphocytes (P < 0.01) and lower CD4-CD8 ratios (P < 0.01) were observed in the HIV+ individuals. Epidermal ICAM-1 and HLA-DR expression was negative in both HIV+ and normal skin biopsies. No evidence of a depletion of the SIS population or of epidermal immunoactivation in normal skin from HIV+ individuals was demonstrable, suggesting that alterations in the central immune system are not necessarily reflected in the SIS of HIV-infected patients.

Skin morphology of the mutant hairless USP mouse

The morphology of the skin of the mutant hairless USP mouse was studied by histological, histochemical and immunohistochemical methods and compared to the skin of BALB/c mice. Representative sections of the dorsal skin from mice of both strains aged 18 days, and 1, 3, 6, and 8 months were studied. Sections stained with hematoxylin and eosin showed cystic formations called utricles and dermal cysts in the dermis that increased in size and number during growth. Skin thickness increased significantly at 8 months. Sections stained with picrosirius and examined with polarized light, displayed different colors, suggesting different thicknesses of dermal collagen fibers (probably types I and III). Weigert, Verhoeff and resorcin-fuchsin stains revealed fibers of the elastic system. The PAS and Alcian blue methods revealed neutral and acid glycosaminoglycans in the skin ground substance of both mouse strains. Immunohistochemical staining for fibronectin and laminin did not show differences between the mutant and BALB/c mice. Mast cells stained by the Gomori method and macrophages positive for HAM 56 antibodies were observed in both mouse strains. Except for the presence of enlarged cysts in the hairless strain, no qualitative differences were found during development of the skin of BALB/c and the mutant hairless mice.

An extract of Polygonum multiflorum protects against free radical damage induced by ultraviolet B irradiation of the skin

Over the last decades, the incidence of ultraviolet B (UVB)-related skin problems has been increasing. Damages induced by UVB radiation are related to mutations that occur as a result of direct DNA damage and/or the production of reactive oxygen species. We investigated the anti-oxidant effects of a Polygonum multiflorum thumb extract against skin damage induced by UVB irradiation. Female SKH-1 hairless mice were divided into three groups: control (N = 7), distilled water- (N = 10), and P. multiflorum extract-treated (PM, N = 10) groups. The PM (10 g) was extracted with 100 mL distilled water, cryo-dried and 9.8 g was obtained. The animals received a topical application of 500 µL distilled water or PM extract (1, 2, 4, 8, and 16%, w/v, dissolved in distilled water) for 30 min after UVB irradiation (wavelength 280-320 nm, 300 mJ/cm²; 3 min) of the dorsal kin for 14 days, and skin immunohistochemistry and Cu,Zn-superoxide dismutase (SOD1) activity were determined. SOD1 immunoreactivity, its protein levels and activities in the skin were significantly reduced by 70% in the distilled water-treated group after UVB irradiation compared to control. However, in the PM extract-treated groups, SOD1 immunoreactivity and its protein and activity levels increased in a dose-dependent manner (1-16%, w/v, PM extract) compared to the distilled water-treated group. SOD1 protein levels and activities in the groups treated with 8 and 16%, w/v, PM extract recovered to 80-90% of the control group levels after UVB. These results suggest that PM extract strongly inhibits the destruction of SOD1 by UV radiation and probably contains anti-skin photoaging agents.

Anti-Leishmania titers and positive skin tests in patients cured of kala-azar

Visceral leishmaniasis (VL), also known as kala-azar, is an important public health problem. If not treated, virtually all clinically symptomatic patients die within months. The diagnosis is based on the Montenegro skin test (MST) and anti-Leishmania titers. Nevertheless, the time required for cured individuals living in a leishmaniasis-endemic area to present a positive skin test and negative anti-Leishmania serology is known. To determine the cellular and humoral immune response profile in relation to different times post-VL cure, a cross-sectional study was conducted on subjects from a kala-azar endemic area in Paço do Lumiar, MA, Brazil, on the basis of 1995-2005 notifications reported by the National Health Foundation/Regional Coordination of Maranhão. We visited cured individuals with a history of VL within the last 10 years. Seventy-four subjects (30 females) ranging in age from 1 to 44 years were included, all of them symptom free at the time of the study. A cellular immune response was observed in 73 (98.6%) subjects, whereas no significant antibody titers were detected by indirect immunofluorescence (IIF) in the sera of 69 (93.2%) cases. Ten years post-cure, 39 (52%) subjects had a positive MST and negative IIF reaction, while in one subject the skin and anti-Leishmania serology tests were negative. Two other subjects were positive in both tests 1 year after cure. These data suggest that a cellular immune response may still be present in subjects cured of VL regardless of post-cure time, and that the parasite persists in the host after clinical cure of the disease. This would explain the persistence of significant Leishmania sp antibody titers in some subjects after treatment.

Prolonged acceptance of skin grafts induced by B cells places regulatory T cells on the histopathology scene

The participation of regulatory T (Treg) cells in B cell-induced T cell tolerance has been claimed in different models. In skin grafts, naive B cells were shown to induce graft tolerance. However, neither the contribution of Treg cells to B cell-induced skin tolerance nor their contribution to the histopathological diagnosis of graft acceptance has been addressed. Here, using male C57BL/6 naive B cells to tolerize female animals, we show that skin graft tolerance is dependent on CD25+ Treg cell activity and independent of B cell-derived IL-10. In fact, B cells from IL-10-deficient mice were able to induce skin graft tolerance while Treg depletion of the host inhibited 100% graft survival. We questioned how Treg cell-mediated tolerance would impact on histopathology. B cell-tolerized skin grafts showed pathological scores as high as a rejected skin from naive, non-tolerized mice due to loss of skin appendages, reduced keratinization and mononuclear cell infiltrate. However, in tolerized mice, 40% of graft infiltrating CD4+ cells were FoxP3+ Treg cells with a high Treg:Teff (effector T cell) ratio (6:1) as compared to non-tolerized mice where Tregs comprise less than 8% of total infiltrating CD4 cells with a Treg:Teff ratio below 1:1. These results render Treg cells an obligatory target for histopathological studies on tissue rejection that may help to diagnose and predict the outcome of a transplanted organ.

Relationship of macrophage migration inhibitory factor levels in PBMCs, lesional skin and serum with disease severity and activity in vitiligo vulgaris

Melanocyte loss in vitiligo vulgaris is believed to be an autoimmune process. Macrophage migration inhibitory factor (MIF) is involved in many autoimmune skin diseases. We determined the possible role of MIF in the pathogenesis of vitiligo vulgaris, and describe the relationship between MIF expressions and disease severity and activity. Serum MIF concentrations and mRNA levels in PBMCs were measured in 44 vitiligo vulgaris patients and 32 normal controls, using ELISA and real-time RT-PCR. Skin biopsies from 15 patients and 6 controls were analyzed by real-time RT-PCR. Values are reported as median (25th-75th percentile). Serum MIF concentrations were significantly increased in patients [35.81 (10.98-43.66) ng/mL] compared to controls [7.69 (6.01-9.03) ng/mL]. MIF mRNA levels were significantly higher in PBMCs from patients [7.17 (3.59-8.87)] than controls [1.67 (1.23-2.42)]. There was also a significant difference in MIF mRNA levels in PBMCs between progressive and stable patients [7.86 (5.85-9.13)vs 4.33 (2.23-8.39)] and in serum MIF concentrations [40.47 (27.71-46.79) vs 26.80 (10.55-36.07) ng/mL]. In addition, the vitiligo area severity index scores of patients correlated positively with changes of both serum MIF concentrations (r = 0.488) and MIF mRNA levels in PBMCs (r = 0.426). MIF mRNA levels were significantly higher in lesional than in normal skin [2.43 (2.13-7.59)vs 1.18 (0.94-1.83)] and in patients in the progressive stage than in the stable stage [7.52 (2.43-8.84)vs 2.13 (1.98-2.64)]. These correlations suggest that MIF participates in the pathogenesis of vitiligo vulgaris and may be useful as an index of disease severity and activity.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

High prevalence of methicillin resistance and PVL genes amongStaphylococcus aureus isolates from the nares and skin lesions of pediatric patients with atopic dermatitis

Staphylococcus aureus is highly prevalent among patients with atopic dermatitis (AD), and this pathogen may trigger and aggravate AD lesions. The aim of this study was to determine the prevalence of S. aureus in the nares of pediatric subjects and verify the phenotypic and molecular characteristics of the isolates in pediatric patients with AD. Isolates were tested for antimicrobial susceptibility, SCCmectyping, and Panton-Valentine Leukocidin (PVL) genes. Lineages were determined by pulsed-field gel electrophoresis and multilocus sequence typing (MLST). AD severity was assessed with the Scoring Atopic Dermatitis (SCORAD) index. Among 106 patients, 90 (85%) presented S. aureus isolates in their nares, and 8 also presented the pathogen in their skin infections. Two patients had two positive lesions, making a total of 10 S. aureusisolates from skin infections. Methicillin-resistant S. aureus(MRSA) was detected in 24 (26.6%) patients, and PVL genes were identified in 21 (23.3%), including 6 (75%) of the 8 patients with skin lesions but mainly in patients with severe and moderate SCORAD values (P=0.0095). All 24 MRSA isolates were susceptible to trimethoprim/sulfamethoxazole, while 8 isolates had a minimum inhibitory concentration (MIC) to mupirocin >1024 μg/mL. High lineage diversity was found among the isolates including USA1100/ST30, USA400/ST1, USA800/ST5, ST83, ST188, ST718, ST1635, and ST2791. There was a high prevalence of MRSA and PVL genes among the isolates recovered in this study. PVL genes were found mostly among patients with severe and moderate SCORAD values. These findings can help clinicians improve the therapies and strategies for the management of pediatric patients with AD.

Physical and chemical properties of wami tilapia skin gelatin

Gelatin was extracted from the skin of tilapia (Oreochromis urolepis hornorum) and characterized according to its physical and chemical properties. It had pH 4.66, which is slightly higher than the values reported for gelatins processed by acid solubilization. In general, the ionic content was low, and the average yield of the process was 5.10 g/100 g. The proximal composition of the gelatin was similar to that of the commercial gelatins, with slightly higher moisture content. The tilapia skin gelatin had whitish-yellow color and average turbidity of 67 NTU.