Carbamazepine can induce kidney water absorption by increasing aquaporin 2 expression

Background. Carbamazepine (Carba) is an anticonvulsant and psychotropic drug used widely for the treatment of intellectual disability and severe pains, but the incidence of hyponatremia is a common related occurrence. This hyponatremia is frequently attributed to a SIADH induced by this drug. It is also known that Carba is used to decrease the urinary volume in Diabetes Insipidus (DI) because it has an antidiuretic effect. Lithium (Li) is one of the most important drugs used to treat bipolar mood disorders. However Li has the undesirable capacity to induce DI. Nowadays, the association of these drugs is used in the treatment of patients with psychiatric and neurological problems. Methods. In vivo and in vitro (microperfusion) experiments were developed to investigate the effect of Carba in the rat Inner Medullary Collecting Duct (IMCD). Results. The results revealed that Carba was able to stimulate the V2 vasopressin receptor-Protein G complex increasing the water permeability (Pf) and water absorption. In vivo studies showed that in rats with lithium-induced DI, Carba decreased the urinary volume and increased the urinary osmolality. AQP2 expression was increased both in normal IMCD incubated with Carba and in IMCD from lithium-induced DI after Carba addition to the diet, when compared with the control. Conclusion. These results showed that the hyponatremia observed in patients using this anticonvulsant drug, at least in part, is due to the Carba capacity to increase IMCD`s Pf and that the Lithium-Carbamazepine association is beneficial to the patient.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Urinary glycosaminoglycans as biomarker for urothelial injury: Is it possible to discriminate damage from recovery?

OBJECTIVES The glycosaminoglycan (GAG) layer is referred to as a bladder protective factor. We reproduced an experimental model of urothelial damage to assess GAG metabolism in the process of injury and recovery of the urothelium. METHODS Wistar female rats were bladder catheterized and instilled with either protamine sulfate (PS groups) or sterile saline (control groups). At different days after the procedure, 24-hour urine samples were obtained. The urinary levels of hyaluronic acid (HA) and sulfated glycosaminoglycan were determined in all groups and in nonmanipulated rats (day 0). Additionally, sulfated-GAG synthesis was assessed by the incorporation of [S-35]-inorganic sulfate. The bladders were analyzed by histochemical staining for HA and immunofluorescence for heparin sulfate and syndecan-4. RESULTS Urinary HA and sulfated-GAG were elevated after PS injection (P <0.05). A greater concentration of [S-35] -labeled GAG in the PS group animals on the fifth day and, especially, on the seventh day represented increased GAG synthesis at these periods (P <0.05). Bladder sections from the PS group animals on day 1 showed a greater amount of HA in the urothelium. PS instillation damaged the urothelium layer of heparin sulfate and syndecan-4 seen in the control animals. On day 5, patchy areas of a restored layer were seen, and, on day 7, this layer had completely regenerated. CONCLUSIONS Urinary GAG cannot differentiate urothelial damage from recovery. Elevated levels of urinary GAG can result from either desquamation of the surface cell GAG layer or increased GAG synthesis to regenerate the damaged urothelium.

Evidence that two independent host genes influence the severity of tissue damage and susceptibility to acute pyelonephritis in murine systemic candidiasis

Tissue damage in the kidney and brain after systemic infection with Candida albicans was examined in recombinant inbred strains (AKXL) derived from AKR and C57/L progenitors. Nine of the 15 strains showed mild (C57/L-like) tissue damage. Of the remainder, two strains developed lesions comparable to the AKR parental strain, whereas four exhibited a much move severe pattern of tissue damage. This was characterized by pronounced mycelial growth in the brain, and gross oedema of the kidney, with extensive fungal colonization and marked tissue destruction. The presence of the null allele of the haemolytic complement gene (Hc) may be necessary but not sufficient, for the expression of the very severe lesions. The results were interpreted as reflecting the actions of two independent genes, which have been designated Carg1 and Carg2 (Candida albicans resistance genes 1 and 2). (C) 1997 Academic Press Limited.

Supersonic velocimetry in a shock tube using laser enhanced ionisation and planar laser induced fluorescence

A novel flow-tagging technique is presented which was employed to measure gas velocities in the free stream of a shock tube. This method is based on the laser spectroscopic techniques of Laser-Enhanced Ionisation (LEI) and Laser-Induced Fluorescence (LIF). The flow in the shock tube is seeded with small amounts of sodium, and LEI is used to produce a substantial depletion of neutral sodium atom concentration in a well-defined region of the flow, by using two wavelength-resonance excitation and subsequent collisional ionisation. At a specific time delay, single-laser-pulse planar LIF is utilised to produce a two-dimensional (2-D) inverse image of the depleted tagged region downstream of the flow. By measuring the displacement of the tagged region, free stream velocities in a shock tube were determined. Large variations in the concentration of sodium seeded into the flow were observed and even in the presence of these large variations accurate free-stream velocity measurements were obtained. The experimentally determined value for velocity compares very well with the predicted velocity.

Peptides containing T cell epitopes, derived from Sm14, but not from paramyosin, induce a Th1 type of immune response, reduction in liver pathology and partial protection against Schistosoma mansoni infection in mice

Sm14 and paramyosin are two major Schistosoma mansoni vaccine candidate antigens. Recently, we have identified Sm14 and paramyosin epitopes that are recognized by T cells of resistant individuals living in endemic areas for schistosomiasis. Herein, mice were immunized with these peptides separately or in association in order to evaluate their vaccine potential. Immunization of mice with Sm14 peptides alone or mixed with paramyosin peptides was able to induce 26%-36.7% or 28%-29.2% of worm burden reduction, 67% or 46% of intestinal eggs reduction and also 54%-61% or 43%-52% of liver pathology reduction, respectively. Protection was associated with a Th1 type of immune response induced by Sm14 peptide immunization. In contrast, paramyosin peptide vaccination did not engender protective immunity or liver pathology reduction and immunization was associated with a Th2 type of immune response. (C) 2008 Elsevier B.V. All rights reserved.

Osteoprotegerin/RANKL system imbalance in active polyarticularonset juvenile idiopathic arthritis: a bone damage biomarker?

Objective: To evaluate the importance of receptor activator of nuclear factor kappa B (RANK)/receptor activator of nuclear factor kappa B ligand (RANKL)/osteoprotegerin (OPG) modulation in active polyarticular juvenile idiopathic arthritis (pJIA) patients with and without bone erosions. Methods: Thirty female patients (mean age 11.07 +/- 3.77 years, range 4-17 years) with active pJIA and 30 healthy gender-and age-matched controls were consecutively selected for this study. All involved articulations were assessed by X-ray and examined for the presence of bone erosions. The serum levels of RANKL and OPG were measured using an enzyme-linked immunosorbent assay (ELISA). Results: Patients with active pJIA had higher levels of serum RANKL than controls [2.90 (0.1-37.4) vs. 0.25 (0.1-5.7) pg/mL, p=0.007] and a lower OPG/RANKL ratio [21.25 (1.8-897.6) vs. 347.5 (9-947.8), p=0.005]. However, levels of OPG were comparable in both groups [55.24 (28.34-89.76) vs. 64.42 (30.68-111.28) pg/mL, p=0.255]. Higher levels of serum RANKL and a lower OPG/RANKL ratio were also observed in active pJIA patients with bone erosions compared to controls [3.49 (0.1-37.4) vs. 0.25 (0.1-5.7) pg/mL, p=0.0115 and 14.3 (1.8-897.6) vs. 347.5 (9-947.8), p=0.016]. However, RANKL levels and OPG/RANKL ratio were similar in pJIA patients without bone erosion and controls [1.75 (0.1-10.9) vs. 0.25 (0.1-5.7) pg/mL, p=0.055 and 29.2 (3.3-756.8) vs. 347.5 (9-947.8), p=0.281]. Conclusion: These data suggest that active pJIA with bone erosions is associated with high serum levels of RANKL and a low OPG/RANKL ratio, indicating that these alterations may reflect bone damage in this disease.

PPAR gamma expression is increased in systemic lupus erythematosus patients and represses CD40/CD40L signaling pathway

Systemic lupus erythematosus (SLE) is a heterogeneous disease involving several immune cell types and pro-inflammatory signals, including the one triggered by binding of CD40L to the receptor CD40. Peroxisome-proliferator activated receptor gamma (PPAR gamma) is a transcription factor with anti-inflammatory properties. Here we investigated whether CD40 and PPAR gamma could exert opposite effects in the immune response and the possible implications for SLE. Increased PPAR gamma mRNA levels were detected by real-time PCR in patients with active SLE, compared to patients with inactive SLE PPAR gamma/GAPDH mRNA = 2.21 +/- 0.49 vs. 0.57 +/- 0.14, respectively (p < 0.05) or patients with infectious diseases and healthy subjects (p < 0.05). This finding was independent of the corticosteroid therapy. We further explored these observations in human THP1 and in SLE patient-derived macrophages, where activation of CD40 by CD40L promoted augmented PPAR gamma gene transcription compared to non-stimulated cells (PPAR gamma/GAPDH mRNA = 1.14 +/- 0.38 vs. 0.14 +/- 0.01, respectively; p < 0.05). This phenomenon occurred specifically upon CD40 activation, since lipopolysaccharide treatment did not induce a similar response. In addition, increased activity of PPAR gamma was also detected after CD40 activation, since higher PPAR gamma-dependent transcription of CD36 transcription was observed. Furthermore, CD40L-stimulated transcription of CD80 gene was elevated in cells treated with PPAR gamma-specific small interfering RNA (small interfering RNA, siRNA) compared to cells treated with CD40L alone (CD80/GAPDH mRNA = 0.11 +/- 0.04 vs. 0.05 +/- 0.02, respectively; p < 0.05), suggesting a regulatory role for PPAR gamma on the CD40/CD40L pathway. Altogether, our findings outline a novel mechanism through which PPAR gamma regulates the inflammatory signal initiated by activation of CD40, with important implications for the understanding of immunological mechanisms underlying SLE and the development of new treatment strategies. Lupus (2011) 20, 575-587.

Hormone profile in juvenile systemic lupus erythematosus with previous or current amenorrhea

To identify the underlying mechanism of amenorrhea in juvenile systemic lupus erythematosus (JSLE) patients, thirty-five (11.7%) JSLE patients with current or previous amenorrhea were consecutively selected among the 298 post-menarche patients followed in 12 Brazilian pediatric rheumatology centers. Pituitary gonadotrophins [follicle-stimulating hormone (FSH) and luteinizing hormone (LH)] and estradiol were evaluated in 32/35 patients, and prolactin and total testosterone in 29/35 patients. Patient`s medical records were carefully reviewed according to demographic, clinical and therapeutic findings. The mean duration of amenorrhea was 7.2 +/- A 3.6 months. Low FSH or LH was observed in 7/32 (22%) JSLE patients and normal FSH or LH in 25 (78%). Remarkably, low levels of FSH or LH were associated with higher frequency of current amenorrhea (57% vs. 0%, P = 0.001), higher median disease activity (SLEDAI) and damage (SLICC/ACR-DI) (18 vs. 4, P = 0.011; 2 vs. 0, P = 0.037, respectively) and higher median current dose of prednisone (60 vs. 10 mg/day, P = 0.0001) compared to normal FSH or LH JSLE patients. None of them had decreased ovarian reserve and premature ovarian failure. Six of 29 (21%) patients had high levels of prolactin, and none had current amenorrhea. No correlations were observed between levels of prolactin and SLEDAI, and levels of prolactin and SLICC/ACR-DI scores (Spearman`s coefficient). We have identified that amenorrhea in JSLE is associated with high dose of corticosteroids indicated for active disease due to hypothalamic-pituitary-ovary axis suppression.

Small volume resuscitation with 3% hypertonic saline solution decrease inflammatory response and attenuates end organ damage after controlled hemorrhagic shock

BACKGROUND: Recently, studies have been conducted examining the efficacy of 3% hypertonic saline solution (HS) for the treatment of traumatic brain injury; however, few studies have analyzed the effects of 3% hemorrhagic shock during hemorrhagic shock. The aim of this study was to test the potential immunomodulatory benefits of 3% hemorrhagic shock resuscitation over standard fluid resuscitation. METHODS: Wistar rats were bled to a mean arterial pressure of 35 mm Hg and then randomized into 3 groups: those treated with lactated Ringer`s solution (LR; 33 mL/kg, n = 7), 3% HS (10 mL/kg, n = 7), and 7.5% HS (4 mL/kg, n = 7). Half of the extracted blood was reinfused after fluid resuscitation. Animals that did not undergo shock served as controls (n = 5). Four hours after hemorrhagic shock, blood was collected for the evaluation of tumor necrosis factor-a and interleukin-6 by enzyme immunoassay. Lung and intestinal samples were obtained for histopathologic analysis. RESULTS: Animals in the HS groups had significantly higher mean arterial pressure than those in the LR group 1 hour after treatment. Osmolarity and sodium levels were markedly elevated in the HS groups. Tumor necrosis factor-alpha and interleukin-6 levels were similar between the control and HS groups but significantly higher in the LR group (P < .05). The lung injury score was significantly higher in the LR group compared with the 7.5% HS and 3% HS groups (5.7 +/- 0.7, 2.1 +/- 0.4, and 2.7 +/- 0.5, respectively). Intestinal injury was attenuated in the 7.5% HS and 3% HS groups compared with the LR group (2.0 +/- 0.6, 2.3 +/- 0.4, and 5.9 +/- 0.6, respectively). CONCLUSIONS: A small-volume resuscitation strategy modulates the inflammatory response and decreases end-organ damage after HS. Three percent HS provides immunomodulatory and metabolic effects similar to those observed with conventional concentrations of HS. (C) 2009 Elsevier Inc. All rights reserved.

Measurements of neutral atom diffusion and electron-ion recombination by laser enhanced ionisation and planar laser induced fluorescence in an air-acetylene flame

The spatial and temporal evolution of a depleted atomic distribution created by laser enhanced ionisation (LEI) was employed to determine both a diffusion coefficient for sodium (Na) and an electron (e(-)) and sodium ion recombination rate coefficient in an analytical air-C2H2 flame. A depleted distribution of neutral sodium atoms was produced in a flame by ionising approximately 80% of the irradiated sodium atoms in a well defined region using a two step LEI excitation scheme. Following depletion by ionisation, planar laser induced fluorescence (PLIF) images of the depleted region recorded the diffusion and decay of the depleted Na distribution for different depletion-probe delays. From measurements of the diffused width of the distribution, an accurate diffusion coefficient D = (1.19 +/- 0.03) x 10(-3) m(2) s(-1) for Na was determined in teh burnt gases of the flame. Measurements of the integrated fluorescence intensity in the depleted region for different depletion-probe delays were related to an increase in atomic sodium concentration caused by electron-ion recombination. At high concentrations (greater than or equal to 50 mu g ml(-1)), where the electron and ion concentrations in the depleted region were assumed equal, a recombination rate coefficient of 4.2 x 10(-9) cm(3) s(-1) was calculated. (C) 1997 Elsevier Science B.V.

Low-Level Laser Therapy in Chronic Autoimmune Thyroiditis: A Pilot Study

Background and Objectives: Chronic autoimmune thyroiditis (CAT) remains the most common cause of acquired hypothyroidism There is currently no therapy that is capable of regenerating CAT-damaged thyroid tissue The objective of this study was to gauge the value of applying low-level laser therapy (LLLT) in CAT patients based on both ultrasound studies (USs) and evaluations of thyroid function and thyroid autoantibodies. Study Design/Materials and Methods: Fifteen patients who had hypothyroidism caused by CAT and were undergoing levothyroxine (LT4) treatment were selected to participate in the study Patients received 10 applications of LLLT (830 nm, output power 50 mW) in continuous mode, twice a week, using either the punctual technique (8 patients) or the sweep technique (7 patients), with fluence in the range of 38-108 J/cm(2) USs were performed prior to and 30 days after LLLT USs included a quantitative analysis of echogenicity through a gray-scale computerized histogram index (El). Following the second ultrasound (30 days after LLLT), LT4 was discontinued in all patients and, if required, reintroduced Truodothyronine, thyroxine (T4), free T4, thyrotropin, thyroid peroxidase (TPOAb) and thyroglobulin (TgAb) antibodies levels were assessed before LLLT and then 1, 2, 3, 6, and 9 months after LT4 withdrawal. Results: We noted all patients` reduced LT4 dosage needs, including 7 (47%) who did not require any LT4 through the 9-month follow-up The LT4 dosage used pre-LLLT (96 +/- 22 mu g/day) decreased in the 9th month of follow-up (38 23 mu g/day; P<0.0001) TPOAb levels also decreased (pre-LLLT = 982 +/- 530 U/ml, post-LLLT = 579 454 U/ml, P = 0 016) TgAb levels were not reduced, though we did observe a post-LLLT increase in the EI (pre-LLLT = 0 99 +/- 0.09, post-LLLT= 1.21 +/- 0.19, P=0.001) Conclusion: The preliminary results indicate that LLLT promotes the improvement of thyroid function, as patients experienced a decreased need for LT4, a reduction in TPOAb levels, and an increase in parenchymal echogenicity Lasers Surg. Med. 42:589-596, 2010. (C) 2010 Wiley-Liss, Inc

Antiphase dynamics of a chaotic multimode laser

Antiphase dynamics of an optically pumped NH3 bidirectional ring laser under the chaotic, phase-sensitive mode coupling is experimentally observed. Our experimental result suggests strongly that the dynamics is a generic behavior of the laser.

Sialylation of beta 1 Integrins blocks cell adhesion to galectin-3 and protects cells against galectin-3-induced apoptosis

In previous studies, we determined that beta 1 integrins from human colon tumors have elevated levels of alpha 2-6 sialylation, a modification added by beta-galactosamide alpha-2,6-sialyltranferase I (ST6Gal-I). Intriguingly, the beta 1 integrin is thought to be a ligand for galectin-3 (gal-3), a tumor-associated lectin. The effects of gal-3 are complex; intracellular forms typically protect cells against apoptosis through carbohydrate-independent mechanisms, whereas secreted forms bind to cell surface oligosaccharides and induce apoptosis. In the current study, we tested whether alpha 2-6 sialylation of the beta 1 integrin modulates binding to extracellular gal-3. Herein we report that SW48 colonocytes lacking alpha 2-6 sialylation exhibit beta 1 integrin-dependent binding to gal-3-coated tissue culture plates; however, binding is attenuated upon forced expression of ST6Gal-I. Removal of alpha 2-6 sialic acids from ST6Gal-I expressors by neuraminidase treatment restores gal-3 binding. Additionally, using a blot overlay approach, we determined that gal-3 binds directly and preferentially to unsialylated, as compared with alpha 2-6-sialylated, beta 1 integrins. To understand the physiologic consequences of gal-3 binding, cells were treated with gal-3 and monitored for apoptosis. Galectin-3 was found to induce apoptosis in parental SW48 colonocytes ( unsialylated), whereas ST6Gal-I expressors were protected. Importantly, gal-3-induced apoptosis was inhibited by function blocking antibodies against the beta 1 subunit, suggesting that beta 1 integrins are critical transducers of gal-3-mediated effects on cell survival. Collectively, our results suggest that the coordinate up-regulation of gal-3 and ST6Gal-I, a feature that is characteristic of colon carcinoma, may confer tumor cells with a selective advantage by providing a mechanism for blockade of the pro-apoptotic effects of secreted gal-3.