High Prevalence Of Insulin Resistance Assessed By The Glucose Clamp Technique In Hormonal And Non-hormonal Contraceptive Users.

Objective To assess the prevalence of insulin resistance (IR) and associated factors in contraceptive users. Methods A total of 47 women 18 to 40 years of age with a body mass index (kg/m(2)) < 30, fasting glucose levels < 100 mg/dl and 2-hour glucose level < 140 mg/dl after a 75-g oral glucose load were submitted to a hyperinsulinemic-euglycemic clamp. The women were distributed in tertiles regarding M-values. The analysed variables were use of combined hormonal/non-hormonal contraception, duration of use, body composition, lipid profile, glucose levels and blood pressure. Results IR was detected in 19% of the participants. The women with low M-values presented significantly higher body fat mass, waist-to-hip ratio, fasting insulin, HOMA-IR and were nulligravida, showed > 1 year of contraceptive use and higher triglyceride levels. IR was more frequent among combined oral contraceptive users, however no association was observed after regression analysis. Conclusions The prevalence of IR was high among healthy women attending a family planning clinic independent of the contraceptive method used with possible long-term negative consequences regarding their metabolic and cardiovascular health. Although an association between hormonal contraception and IR could not be found this needs further research. Family planning professionals should be proactive counselling healthy women about the importance of healthy habits.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Rehabilitation of severely resorbed edentulous mandible using the modified visor osteotomy technique

The prosthetic rehabilitation of an atrophic mandible is usually unsatisfactory due to the lack of support tissues, mainly bone and keratinized mucosa for treatment with osseointegrated implants or even conventional prosthesis. The prosthetic instability leads to social and functional limitations and chronic physical trauma decreasing the patient's quality of life. A 53-year-old female patient sought care at our surgical service complaining of impairment of her masticatory function associated with the instability of the lower total prosthetic denture. The clinical and complementary exams revealed edentulism in both arches, while the mandibular arch presented severe reabsorption resulting in denture instability and chronic trauma to the oral mucosa. The proposed treatment plan consisted in the mandibular rehabilitation with osseointegrated implants and fixed Brånemark's protocol prosthesis after mandibular reconstruction applying the modified visor osteotomy technique. The proposed technique offered predictable results for reconstruction of the severely resorbed edentulous mandible and posterior rehabilitation with osseointegrated implants.

Nuclear and mitochondrial DNA markers in traceability of retail beef samples

Several characteristics are important in a traceability system of animal products, such as age at slaughter, breed composition, besides information of the productive chain. In general, the certification agent records information about the animals and the system which it came from, although cannot guarantee that the slaughtering, meat processing and distribution are error proof. Besides, there is a differential price, at least at the international market, based on sex and breed composition of the animals. Genetic markers allow identification of characteristics controlled in the beef cattle traceability program, as sex and breed composition, in order to correctly identify and appraise the final product for the consumer. The hypothesis of this study was that the majority beef samples retailed in the local market originate from female with a great participation of zebu breeds. Therefore, the objective of this work was to characterize retail beef samples with DNA markers that identify cattle sex and breed composition. Within 10 beef shops localized in Pirassununga, SP, Brazil, 61 samples were collected, all were genotyped as harboring Bos taurus mitochondrial DNA and 18 were positive for the Y chromosome amplification (male). For the marker sat1711b-Msp I the frequency of the allele A was 0.278 and for the marker Lhr-Hha I the frequency of the allele T was 0.417. The results of sat1711b-Msp I and Lhr-Hha I allelic frequencies are suggestive that the proportion of indicus genome compared with the taurine genome in the market meat is smaller than the observed in the Nellore breed. The procedure described in this study identified sex and subspecies characteristics of beef meat samples, with potential application in meat products certification in special as an auxiliary tool in beef cattle traceability programs.

Melatonin in maturation media fails to improve oocyte maturation, embryo development rates and DNA damage of bovine embryos

Melatonin (MEL) acts as a powerful scavenger of free radicals and direct gonadal responses to melatonin have been reported in the literature. Few studies, however, have evaluated the effect of MEL during in vitro maturation (IVM) on bovine embryos. This study tested the addition of MEL to maturation medium (MM) with no gonadotropins on nuclear maturation and embryo development rates and the incidence of DNA damage in resulting embryos. Cumulus-oocyte complexes were aspirated from abattoir ovaries and cultured in MM (TCM-199 medium supplemented with 10% fetal calf serum - FCS) at 39ºC and 5% CO2 in air. After 24 hours of culture in MM with 0.5 µg mL-1 FSH and 5.0 µg mL-1 LH; 10-9 M MEL) or 10-9 M MEL, 0.5 µg mL-1 FSH and 5.0 µg mL-1 LH, the oocytes were stained with Hoechst 33342 to evaluate nuclear maturation rate. After in vitro fertilization and embryo culture, development rates were evaluated and the blastocysts were assessed for DNA damage by Comet assay. There was no effect of melatonin added to the MM, alone or in combination with gonadotropins, on nuclear maturation, cleavage and blastocyst rates. These rates ranged between 88% to 90%, 85% to 88% and 42% to 46%, respectively. The extent of DNA damage in embryos was also not affected by MEL supplementation during IVM. The addition of 10-9 M MEL to the MM failed to improve nuclear maturation and embryo development rates and the incidence of DNA damage in resulting embryos, but was able to properly substitute for gonadotropins during IVM.

Evaluation of DNA extraction protocols for Brucella abortus pcr detection in aborted fetuses or calves born from cows experimentally infected with strain 2308

The objective of the present study was to improve the detection of B. abortus by PCR in organs of aborted fetuses from infected cows, an important mechanism to find infected herds on the eradication phase of the program. So, different DNA extraction protocols were compared, focusing the PCR detection of B. abortus in clinical samples collected from aborted fetuses or calves born from cows challenged with the 2308 B. abortus strain. Therefore, two gold standard groups were built based on classical bacteriology, formed from: 32 lungs (17 positives), 26 spleens (11 positives), 23 livers (8 positives) and 22 bronchial lymph nodes (7 positives). All samples were submitted to three DNA extraction protocols, followed by the same amplification process with the primers B4 and B5. From the accumulated results for organ, the proportion of positives for the lungs was higher than the livers (p=0.04) or bronchial lymph nodes (p=0.004) and equal to the spleens (p=0.18). From the accumulated results for DNA extraction protocol, the proportion of positives for the Boom protocol was bigger than the PK (p<0.0001) and GT (p=0.0004). There was no difference between the PK and GT protocols (p=0.5). Some positive samples from the classical bacteriology were negative to the PCR and viceversa. Therefore, the best strategy for B. abortus detection in the organs of aborted fetuses or calves born from infected cows is the use, in parallel, of isolation by classical bacteriology and the PCR, with the DNA extraction performed by the Boom protocol.

Genetic evaluation of the mating system in the blue-and-yellow macaw (Ara ararauna, Aves, Psittacidae) by DNA fingerprinting

More than 90% of birds are socially monogamous, although genetic studies indicate that many are often not sexually monogamous. In the present study, DNA fingerprinting was used to estimate the genetic relationships between nestlings belonging to the same broods to evaluate the mating system in the socially monogamous macaw, Ara ararauna. We found that in 10 of 11 broods investigated, the nestlings showed genetic similarity levels congruent with values expected among full-sibs, suggesting that they shared the same parents. However, in one brood, the low genetic similarity observed between nestlings could be a result of intraspecific brood parasitism, intraspecific nest competition or extra-pair paternity. These results, along with available behavioral and life-history data, imply that the blue-and-yellow macaw is not only socially, but also genetically monogamous. However, the occurrence of eventual cases of extra-pair paternity cannot be excluded.

Medida da visão em candelas: description of a psychophysical technique to quantify luminous intensity

OBJETIVO: Desenvolver um método e um dispositivo para quantificar a visão em candela (cd). Os estudos de medida da visão são importantes para todas as ciências visuais. MÉTODOS: É um estudo teórico e experimental. Foram descritos os detalhes do método psicofísico e da calibração do dispositivo. Foram realizados testes preliminares em voluntários. RESULTADOS: É um teste psicofísico simples e com resultado expresso em unidades do sistema internacional de medidas. Com a descrição técnica será possível reproduzir o experimento em outros centros de pesquisa. CONCLUSÃO: Os resultados aferidos em intensidade luminosa (cd) são uma opção para estudo visual. Esses resultados possibilitarão extrapolar medidas para modelos matemáticos e para simular efeitos individuais com dados aberrométricos.

Spatial analysis of urban violence based on emergency room data

OBJECTIVE: To estimate the spatial intensity of urban violence events using wavelet-based methods and emergency room data. METHODS: Information on victims attended at the emergency room of a public hospital in the city of São Paulo, Southeastern Brazil, from January 1, 2002 to January 11, 2003 were obtained from hospital records. The spatial distribution of 3,540 events was recorded and a uniform random procedure was used to allocate records with incomplete addresses. Point processes and wavelet analysis technique were used to estimate the spatial intensity, defined as the expected number of events by unit area. RESULTS: Of all georeferenced points, 59% were accidents and 40% were assaults. There is a non-homogeneous spatial distribution of the events with high concentration in two districts and three large avenues in the southern area of the city of São Paulo. CONCLUSIONS: Hospital records combined with methodological tools to estimate intensity of events are useful to study urban violence. The wavelet analysis is useful in the computation of the expected number of events and their respective confidence bands for any sub-region and, consequently, in the specification of risk estimates that could be used in decision-making processes for public policies.

Evaluation of capillaries with different inner coatings for DNA analysis using dilute polymer solutions by capillary electrophoresis

In this work three capillary columns, one with uncoated inner wall and two with covalently-bound internal coatings - poly(vinyl alcohol) (PVA) and poly(dimethylacrylamide) (PDMA) - both covalently covered - were used to separate DNA fragments and compared to DNA separation using replaceable polymer solutions. The separations were performed using hydroxyethylcellulose (HEC) (90-105 kDa) in concentrations ranging from 0.00 to 2.00% m/v. The results indicated that the separation efficiency was higher in the PVA capillary than in the PDMA in all evaluated concentrations of HEC. In addition, higher resolution was also observed in PVA-coated capillary since in PDMA the shape of the peaks was not reproducible when subsequent runs were performed. Contrary to what has previously been reported in the literature, no reasonable separation was possible in bare fused silica.

Synthesis and structural characterization of block and random low molecular weight copolymers composed of L-lactic acid and isosorbide succinate moieties

Isosorbide succinate moieties were incorporated into poly(L-lactide) (PLLA) backbone in order to obtain a new class of biodegradable polymer with enhanced properties. This paper describes the synthesis and characterization of four types of low molecular weight copolymers. Copolymer I was obtained from monomer mixtures of L-lactide, isosorbide, and succinic anhydride; II from oligo(L-lactide) (PLLA), isosorbide, and succinic anhydride; III from oligo(isosorbide succinate) (PIS) and L-lactide; and IV from transesterification reactions between PLLA and PIS. MALDI-TOFMS and 13C-NMR analyses gave evidence that co-oligomerization was successfully attained in all cases. The data suggested that the product I is a random co-oligomer and the products II-IV are block co-oligomers.

Oxidative DNA damage induced by S(IV) in the presence of Cu(II) and Cu(I) complexes

The DNA damage induced by S(IV) in the presence of some Cu(II) complexes in air saturated solution was investigated. The addition of S(IV) to an air saturated solution containing CuII GGA (GGA = glycylglycyl-L-alanine), CuII G3 (G3 = triglycine) or CuII G4 (G4 = tetraglycine) and Ni(II) traces, causes rapid formation of the respective Cu(III) complex, with simultaneous O2 uptake and S(IV) oxidation. SO3•- and HO• were detected by EPR-spin trapping experiments. The DNA strand breaks were attributed to the oxysulfur radicals formed. In the reduction of Cu(II)/BCA (BCA = 4,4' dicarboxy-2-2'-biquinoline) by S(IV), with CuI BCA complex formation, there is the possible formation of carbon centered radical of BCA or peroxyl radical (ROO•) capable of oxidizing DNA bases. The intensity of DNA damage in the presence of these Cu(II) complexes and S(IV) (10-300 µmol L-1) followed the order: CuII BCA ∼ CuII G4 ∼ Cu(II) (added as Cu(NO3)2) > CuII G3 ∼ CuII GGA. Specifically for CuII BCA the damage occurred even at lower S(IV) concentration (0.1 µmol L-1). For the Cu(II) complexes with glycylglycylhistidine, glycylhistidylglycine, glycylhistidyllysine and glycylglycyltyrosylarginine the Cu(III) formation and the DNA damage was not observed.

Protocol for DNA extraction of Cryptosporidium spp. oocysts in fecal samples

Molecular characterization of Cryptosporidium spp.oocysts in clinical samples is useful for public health since it allows the study of sources of contamination as well as the transmission in different geographical regions. Although widely used in developed countries, in Brazil it is restricted to academic studies, mostly using commercial kits for the extraction of genomic DNA, or in collaboration with external reference centers, rendering the method expensive and limited. The study proposes the application of the modifications recently introduced in the method improving feasibility with lower cost. This method was efficient for clinical samples preserved at -20 °C for up to six years and the low number of oocysts may be overcomed by repetitions of extraction.

Rickettsial spotted fever in capoeirão Village, Itabira, Minas Gerais, Brazil

The present study investigated the infection by spotted fever rickettsia in an endemic area for Brazilian spotted fever (BSF; caused by Rickettsia rickettsii) in Minas Gerais State, Brazil. Human, canine and equine sera samples, and Amblyomma cajennense adult ticks collected in a rural area of Itabira City, Minas Gerais State were tested for rickettsial infection. Through Immunofluorescence Assay (IFA) we demonstrated the presence of antibodies anti-R. rickettsii in 8.2%, 81.3% and 100% of the human, canine and equine sera, respectively. None of the 356 tick specimens analyzed were positive for Rickettsia by the hemolymph test or Polymerase Chain Reaction technique (PCR) for the htrA and the gltA genes. Our serological results on horses and dogs (sentinels for BSF) appoint for the circulation of a SFG Rickettsia in the study area, however in a very low infection rate among the A. cajennense tick population.