Normal skin and hypertrophic scar fibroblasts differentially regulate collagen and fibronectin expression as well as mitochondrial membrane potential in response to basic fibroblast growth factor

Basic fibroblast growth factor (bFGF) regulates skin wound healing; however, the underlying mechanism remains to be defined. In the present study, we determined the effects of bFGF on the regulation of cell growth as well as collagen and fibronectin expression in fibroblasts from normal human skin and from hypertrophic scars. We then explored the involvement of mitochondria in mediating bFGF-inducedeffects on the fibroblasts. We isolated and cultivated normal and hypertrophic scar fibroblasts from tissue biopsies of patients who underwent plastic surgery for repairing hypertrophic scars. The fibroblasts were then treated with different concentrations of bFGF (ranging from 0.1 to 1000 ng/mL). The growth of hypertrophic scar fibroblasts became slower with selective inhibition of type I collagen production after exposure to bFGF. However, type III collagen expression was affected in both normal and hypertrophic scar fibroblasts. Moreover, fibronectin expression in the normal fibroblasts was up-regulated after bFGF treatment. bFGF (1000 ng/mL) also induced mitochondrial depolarization in hypertrophic scar fibroblasts (P < 0.01). The cellular ATP level decreased in hypertrophic scar fibroblasts (P < 0.05), while it increased in the normal fibroblasts following treatment with bFGF (P < 0.01). These data suggest that bFGF has differential effects and mechanisms on fibroblasts of the normal skin and hypertrophic scars, indicating that bFGF may play a role in the early phase of skin wound healing and post-burn scar formation.

Exogenous normal lymph alleviates microcirculation disturbances and abnormal hemorheological properties in rats with disseminated intravascular coagulation

Disturbances of the microcirculation and abnormal hemorheological properties are important factors that play an important role in disseminated intravascular coagulation (DIC) and result in organ dysfunction or failure. In the present study, we established an animal model of DIC using intravenous Dextran 500 in rats, and used exogenous normal lymph corresponding to 1/15 of whole blood volume for injection through the left jugular vein. We found that normal lymph could improve the blood pressure and survival time of rats with DIC. The results regarding the mesenteric microcirculation showed that the abnormality of the diameter of mesenteric microvessels and micro-blood flow speed in the DIC+lymph group was significantly less than in the DIC+saline group. Whole blood viscosity, relative viscosity, plasma viscosity, hematocrit (Hct), erythrocyte sedimentation rate (ESR), and electrophoresis time of erythrocytes were significantly increased in the DIC+saline group compared to the control group. The electrophoretic length and migration of erythrocytes from the DIC+saline and DIC+lymph groups were significantly slower than the control group. Blood relative viscosity, Hct, ESR, and electrophoretic time of erythrocytes were significantly increased in the DIC+lymph group compared to the control group. Whole blood viscosity, relative viscosity and reduced viscosity were significantly lower in the DIC+lymph group than in the DIC+saline group, and erythrocyte deformability index was also significantly higher than in the DIC+saline and control groups. These results suggest that exogenous normal lymph could markedly improve the acute microcirculation disturbance and the abnormal hemorheological properties in rats with DIC induced by Dextran 500.

Myosin Va is developmentally regulated and expressed in the human cerebellum from birth to old age

Myosin Va functions as a processive, actin-based motor molecule highly enriched in the nervous system, which transports and/or tethers organelles, vesicles, and mRNA and protein translation machinery. Mutation of myosin Va leads to Griscelli disease that is associated with severe neurological deficits and a short life span. Despite playing a critical role in development, the expression of myosin Va in the central nervous system throughout the human life span has not been reported. To address this issue, the cerebellar expression of myosin Va from newborns to elderly humans was studied by immunohistochemistry using an affinity-purified anti-myosin Va antibody. Myosin Va was expressed at all ages from the 10th postnatal day to the 98th year of life, in molecular, Purkinje and granular cerebellar layers. Cerebellar myosin Va expression did not differ essentially in localization or intensity from childhood to old age, except during the postnatal developmental period. Structures resembling granules and climbing fibers in Purkinje cells were deeply stained. In dentate neurons, long processes were deeply stained by anti-myosin Va, as were punctate nuclear structures. During the first postnatal year, myosin Va was differentially expressed in the external granular layer (EGL). In the EGL, proliferating prospective granule cells were not stained by anti-myosin Va antibody. In contrast, premigratory granule cells in the EGL stained moderately. Granule cells exhibiting a migratory profile in the molecular layer were also moderately stained. In conclusion, neuronal myosin Va is developmentally regulated, and appears to be required for cerebellar function from early postnatal life to senescence.

Nasal CPAP in the delivery room for newborns with extremely low birth weight in a hospital in a developing country

The objective of this study was to determine the feasibility of the use of continuous positive airway pressure installed prophylactically in the delivery room (DR-CPAP), for infants with a birth weight between 500 and 1000 g in settings with limited resources. During 23 months, infants with a birth weight between 500 and 1000 g consecutively received DR-CPAP. A total of 33 infants with low birth weight were enrolled, 16 (48.5%) were females. Only 14 (42.4%) received antenatal corticosteroids and only 2 of those 14 (14.3%) infants weighing 500-750 g were not intubated in the delivery room, and apnea was given as the reason for intubation of these patients. Of the 19 infants in the 751-1000 g weight range, 9 (47.4%) were intubated in the delivery room, 6 due to apnea and 3 due to respiratory discomfort. For DR-CPAP to be successful, it is probably necessary for preterm babies to be more prepared at birth to withstand the respiratory effort without the need for intubation. Antenatal corticosteroids and better prenatal monitoring are fundamental for success of DR-CPAP.

Exogenous normal lymph reduces liver injury induced by lipopolysaccharides in rats

The liver is one of the target organs damaged by septic shock, wherein the spread of endotoxins begins. This study aimed to investigate the effects of exogenous normal lymph (ENL) on lipopolysaccharide (LPS)-induced liver injury in rats. Male Wistar rats were randomly divided into sham, LPS, and LPS+ENL groups. LPS (15 mg/kg) was administered intravenously via the left jugular vein to the LPS and LPS+ENL groups. At 15 min after the LPS injection, saline or ENL without cell components (5 mL/kg) was administered to the LPS and LPS+ENL groups, respectively, at a rate of 0.5 mL/min. Hepatocellular injury indices and hepatic histomorphology, as well as levels of P-selectin, intercellular adhesion molecule 1 (ICAM-1), myeloperoxidase (MPO), and Na+-K+-ATPase, were assessed in hepatic tissues. Liver tissue damage occurred after LPS injection. All levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in plasma as well as the wet/dry weight ratio of hepatic tissue in plasma increased. Similarly, P-selectin, ICAM-1, and MPO levels in hepatic tissues were elevated, whereas Na+-K+-ATPase activity in hepatocytes decreased. ENL treatment lessened hepatic tissue damage and decreased levels of AST, ALT, ICAM-1, and MPO. Meanwhile, the treatment increased the activity of Na+-K+-ATPase. These results indicated that ENL could alleviate LPS-induced liver injury, thereby suggesting an alternative therapeutic strategy for the treatment of liver injury accompanied by severe infection or sepsis.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Plasma levels and placental expression of vaspin in pregnant women with diabetes mellitus

The present study aimed to investigate visceral adipose tissue-specific serpin (vaspin) concentrations in serum and term placentas and relate these values to insulin resistance and lipid parameters in women with gestational diabetes mellitus (GDM). A total of 30 GDM subjects and 27 age-matched pregnant women with normal glucose tolerance (NGT, control) were included. Serum glucose, glycated hemoglobin (HbA1c), lipid profile, insulin, and vaspin were measured at the end of pregnancy, and homeostasis model of assessment-insulin resistance (HOMA-IR) values were calculated. Vaspin mRNA and protein levels in placentas were measured by real-time fluorescence quantitative reverse transcription polymerase chain reaction (RT-qPCR) and Western blotting, respectively. Serum vaspin levels were significantly lower in the GDM group than in controls (0.49±0.24 vs 0.83±0.27 ng/mL, respectively; P<0.01). Three days after delivery, serum vaspin levels were significantly decreased in subjects with GDM (0.36±0.13 vs0.49±0.24 ng/mL, P<0.01). However, in the GDM group, serum vaspin levels were not correlated with the parameters evaluated. In contrast, in the control group, serum vaspin levels were positively correlated with triglycerides (TG; r=0.45, P=0.02) and very low-density lipoprotein cholesterol (VLDL-C; r=0.42, P=0.03). Placental mRNA vaspin (0.60±0.32 vs0.68±0.32, P=0.46) and protein (0.30±0.08 vs0.39±0.26; P=0.33) levels in the GDM group did not differ significantly from those in the control group, but were negatively correlated with neonatal birth weight in the GDM group (r=-0.48, P=0.03; r=-0.88; P<0.01). Our findings indicated that vaspin may be an important adipokine involved in carbohydrate and lipid metabolism and may also play a role in fetal development.

Estrutura dos grânulos de amido de milho normal e ceroso

Visando obter informações a respeito da estrutura dos grânulos, amidos de milho normal e ceroso foram isolados e submetidos à ação da a-amilase e amiloglucosidase. Para elucidar a estrutura dos grânulos, os resíduos desta hidrólise foram submetidos à cromatografia de permeção em gel Sephadex G-50, diretamente e após sucessivas digestões enzimáticas com pululanase e b-amilase. Os resultados mostraram que existem diferenças nos resíduos dos amidos de milho ceroso e normal, tratados com a-amilase e amiloglucosidase. No resíduo do amido de milho ceroso, os perfis de eluição mostraram duas frações a 290 e 350 ml (picos I e II) respectivamente, que não eram suscetíveis ao ataque da a-amilase e amiloglucosidase, indicando que estas frações faziam parte das zonas cristalinas do amido. Estas frações também faziam parte das áreas cristalinas no amido normal. A presença do pico V à 390 ml na a-glucana do amido de milho normal sugeriu que além das duas frações não suscetíveis à hidrólise existia outra que também participava das zonas cristalinas deste amido como regiões não suscetíveis às enzimas formando, consequentemente, rede cristalina fortemente associada. A presença deste pico a 390 ml sugeriu arranjo cristalino distinto entre o amido de milho ceroso e o normal.

Genetic, prenatal and postnatal determinants of weight gain and obesity in young children – The STEPS Study

Genetic, Prenatal and Postnatal Determinants of Weight Gain and Obesity in Young Children – The STEPS Study University of Turku, Faculty of Medicine, Department of Paediatrics, University of Turku Doctoral Program of Clinical Investigation (CLIPD), Turku Institute for Child and Youth Research. Conditions of being overweight and obese in childhood are common health problems with longlasting effects into adulthood. Currently 22% of Finnish boys and 12% of Finnish girls are overweight and 4% of Finnish boys and 2% of Finnish girls are obese. The foundation for later health is formed early, even before birth, and the importance of prenatal growth on later health outcomes is widely acknowledged. When the mother is overweight, had high gestational weight gain and disturbances in glucose metabolism during pregnancy, an increased risk of obesity in children is present. On the other hand, breastfeeding and later introduction of complementary foods are associated with a decreased obesity risk. In addition to these, many genetic and environmental factors have an effect on obesity risk, but the clustering of these factors is not extensively studied. The main objective of this thesis was to provide comprehensive information on prenatal and early postnatal factors associated with weight gain and obesity in infancy up to two years of age. The study was part of the STEPS Study (Steps to Healthy Development), which is a follow-up study consisting of 1797 families. This thesis focused on children up to 24 months of age. Altogether 26% of boys and 17% of girls were overweight and 5% of boys and 4% of girls were obese at 24 months of age according to New Finnish Growth references for Children BMI-for-age criteria. Compared to children who remained normal weight, the children who became overweight or obese showed different growth trajectories already at 13 months of age. The mother being overweight had an impact on children’s birth weight and early growth from birth to 24 months of age. The mean duration of breastfeeding was almost 2 months shorter in overweight women in comparison to normal weight women. A longer duration of breastfeeding was protective against excessive weight gain, high BMI, high body weight and high weight-for-length SDS during the first 24 months of life. Breast milk fatty acid composition differed between overweight and normal weight mothers, and overweight women had more saturated fatty acids and less n-3 fatty acids in breast milk. Overweight women also introduced complementary foods to their infants earlier than normal weight mothers. Genetic risk score calculated from 83 obesogenic- and adiposity-related single nucleotide polymorphisms (SNPs) showed that infants with a high genetic risk for being overweight and obese were heavier at 13 months and 24 months of age than infants with a low genetic risk, thus possibly predisposing to later obesity in obesogenic environment. Obesity Risk Score showed that children with highest number of risk factors had almost 6-fold risk of being overweight and obese at 24 months compared to children with lowest number of risk factors. The accuracy of the Obesity Risk Score in predicting overweight and obesity at 24 months was 82%. This study showed that many of the obesogenic risk factors tend to cluster within children and families and that children who later became overweight or obese show different growth trajectories already at a young age. These results highlight the importance of early detection of children with higher obesity risk as well as the importance of prevention measures focused on parents. Keywords: Breastfeeding, Child, Complementary Feeding, Genes, Glucose metabolism, Growth, Infant Nutrition Physiology, Nutrition, Obesity, Overweight, Programming

Estabilidade de géis de amido de milho normal, ceroso e com alto teor de amilose adicionados de gomas guar e xantana durante os processos de congelamento e descongelamento

O objetivo do presente trabalho foi estudar os efeitos das gomas guar e xantana sobre a estabilidade dos géis de amido de milho normal, ceroso e com alto teor de amilose submetidos aos processos de congelamento e descongelamento. Os géis desses amidos, com concentração total de sólidos de 10% e adicionados das gomas (0,15; 0,50; 0,85 e 1%), foram submetidos a 5 ciclos de congelamento (20 horas a -18 °C) e descongelamento (4 horas a 25 °C), com exceção dos géis com alto teor de amilose, que foram submetidos a apenas 1 ciclo, devido à perda da estrutura de gel. A determinação da sinérese (porcentagem de água liberada) foi realizada pela diferença entre a massa inicial e a massa final das amostras. O gel de amido de milho normal liberou 74,45% de água, sendo que a adição de 1% da goma xantana reduziu significativamente a sinérese para 66,43%. A adição de 0,85 e 1% da goma xantana também reduziu a sinérese dos géis de amido ceroso. O menor teor de sinérese foi obtido com a utilização de 1% de goma xantana ao gel de amido de milho com alto teor de amilose, evidenciando a ação crioprotetora desta goma.

Características qualitativas de produtos elaborados com carne de frango pálida e normal

Foram elaborados hambúrgueres e filés empanados com peitos de frango pálidos e normais e foram realizadas as seguintes análises de qualidade: cor, Perda de Peso por Cozimento (PPC), cisalhamento, Encolhimento por Fritura (EF), TBA, avaliação microbiológica e sensorial para os hambúrgueres, e TBA, análise microbiológica e análise sensorial para os filés empanados. As amostras de hambúrgueres elaboradas não diferiram significativamente (p > 0,05) nos parâmetros de coloração, EF, PPC e análise microbiológica e sensorial. Para análise de força de cisalhamento, houve diferença significativa (p < 0,05) entre os hambúrgueres no período de 7, 60 e 120 dias, sendo que os hambúrgueres elaborados com carne pálida (1,92; 1,31 e 1,46, respectivamente) apresentaram as menores médias quando comparados com os de carne normal (2,34; 1,85 e 1,73, respectivamente). Na análise de TBA, as amostras elaboradas com carne pálida também tiveram os maiores resultados com 90 a 180 dias de estocagem (5,28; 7,78; 8,89; 5,02) quando comparadas às de carne normal (2,62; 7,05; 8,08; 3,89). Para os filés empanados, não foram encontradas diferenças significativas (p > 0,05) entre a elaboração com carne de coloração normal e pálida para os parâmetros avaliados. Estes resultados demonstram que a carne pálida pode ser utilizada para a elaboração de produtos industrializados sem causar prejuízos em sua qualidade.

Caracterização físico-química, reológica, morfológica e térmica dos amidos de milho normal, ceroso e com alto teor de amilose

O objetivo do presente estudo foi avaliar os amidos de milho normal, ceroso e com alto teor de amilose, fabricados pela National Starch, por meio da determinação das suas características físico-químicas, morfológicas, térmicas e reológicas. O amido de milho com alto teor de amilose (AM) apresentou teor de amilose igual a 71%, sendo que os valores obtidos para o amido de milho normal (M) e o amido de milho ceroso (AP) foram de 27,8 e 1,8%, respectivamente. Traços de proteína e lipídios foram encontrados nas amostras. O amido de milho ceroso apresentou maior viscosidade máxima e uma menor tendência à retrogradação, se comparado ao amido de milho normal. O amido AP apresentou menor entalpia de gelatinização, como pode ser observado nas análises de calorimetria exploratória diferencial (DSC), na qual a temperatura de gelatinização foi de 75 °C e o ΔH de 3,34 J.g-1, e também na análise de RVA (Rapid Visco Analyser), em que a temperatura de pasta foi de 71 °C. Apresentando, dessa forma, valores inferiores aos verificados para os outros amidos. O valor do ΔH de retrogradação do amido AP, mostrou-se 25,8% inferior ao ΔH do amido M. O amido AM apresentou o valor de 26,38 J.g-1, demonstrando o maior envolvimento da molécula de amilose no processo de retrogradação. Isso também foi evidenciado pela medida da força dos géis: o gel de AM apresentou força 99,18% superior, retrogradando mais que os outros amidos. As análises de difração de raio X mostraram que os amidos de milho normal e ceroso apresentaram um padrão de difração do tipo A e o amido de milho com alto teor de amilose apresentou padrão do tipo B.

Retenção de aroma na secagem em atmosferas normal e modificada: desenvolvimento do sistema de estudo

Na secagem de determinados alimentos, como frutas, juntamente com a água há também a evaporação de outras substâncias voláteis presentes em quantidades menores. Por isso, torna-se interessante considerar nos estudos de secagem a evaporação, além da água, desses outros componentes voláteis. A modificação da atmosfera tem sido utilizada em armazenamento, principalmente de vegetais, mas pode também ser estendida à secagem, pois pode influenciar a perda de voláteis responsáveis pelas características sensoriais do produto final. No presente trabalho, é apresentado um sistema de secagem previamente desenvolvido, no qual a atmosfera de secagem pode ser modificada pela adição de gases ou líquidos. Desenvolveu-se um sistema-modelo a partir da composição química básica do abacaxi e da adição de outros compostos, contendo um dos principais componentes do aroma desta fruta (hexanoato de etila). Além disso, também foi desenvolvida a metodologia analítica de determinação do aroma no sistema-modelo e no abacaxi, a partir dos estudos de extração de aromas e de análise cromatográfica gasosa. O aroma presente no sistema-modelo foi extraído em hexano e os componentes voláteis do aroma do abacaxi foram extraídos em éter etílico

Opettajattareksi sopimaton? Diskurssianalyysi seminaarien naisoppilaiden poikkeavuuden tulkinnasta ja kontrollista Suomessa 1860 -1960 -luvuilla

Tutkimus sijoittuu konstruktivismin ja kasvatuksen historian alueille. Tutkin diskurssianalyysin keinoin miten opettajiksi opiskelevien tyttö- ja naisoppilaiden poikkeavuuden tulkintoja on luotu, ylläpidetty ja uusinnettu 1860-1960 -lukujen Suomessa. Huomio on siinä miten opettajaseminaarien tyttö- ja naisoppilaiden käyttäytymistä on tulkittu poikkeavaksi opettajakokousten pöytäkirjojen teksteissä; miten poikkeavuutta on luotu diskursseilla - ja miten diskurssit ja niiden tulkinnat ovat olleet sukupuolitettuja. Tutkimusaiheeseen diskurssianalyysi soveltuu niin metodiksi kuin viitekehykseksikin, koska poikkeavuuden, normaalin ja epänormaalin rakentuminen tapahtuu kielenkäytön, vuorovaikutuksen ja sosiaalisen toiminnan keskinäisissä suhteissa. Pyrkimyksenä on tietoisuuden lisääminen niistä prosesseista, joissa näitä poikkeavuuden tulkintoja luotiin. Aineistoni koostuu rangaistustapauksista, jotka ovat kirjattu viiden opettajaseminaarin opettajakokousten pöytäkirjoihin vuosien 1863 - 1962 välisenä aikana. Rikkomustapauksia on yhteensä 1436, joista 194 tyttöoppilaiden tekemiä. Ajanjakso alkaa kansalaisyhteiskunnan ja kansanopetuksen synnystä ja päättyy peruskoulun alkuvaiheisiin. Vaikka seminaarien virallinen ja julkinen säännöstö oli kohdistettu yhtälailla nais- ja miesoppilaille, sisälsivät diskursseihin kätkeytyvät normistot seminaarien tyttö- ja naisoppilaille omat erilliset rajat, joiden ylittäminen teki heistä poikkeavia. Tyttö- ja naisoppilaiden poikkeavuus opettajaseminaareissa on ollut poikkeamista Jumalan säätämästä järjestyksestä, jossa naisella on määrätty paikkansa, asemansa ja tehtävänsä. Kun poika- ja miesoppilaiden normeista ja seminaarien säännöistä poikkeamisia on käsitelty opettajakokouksissa rikoksina, on tyttö- ja naisoppilaiden rikkeitä pyritty näkemään sairauden kaltaisina moraalia ja ymmärrystä heikentävinä tiloina. Ennen kaikkea ne ovat olleet rikkomuksia oikeanlaista naiseutta eli ”tosinaiseuden” mallia vastaan. Naisopettajuuden malli kansan äitinä ja mallikansalaisena sekä nöyrän, alistuvan, vaatimattoman ja säyseän ”tosinaisen” mallit olivat lähes yhdenmukaiset ja ne ovat luoneet ja ylläpitäneet tyttö- ja naisoppilaiden toiseutta. Diskurssit, joilla tätä toiseutta ylläpidettiin, elivät opettajaseminaarien pöytäkirjateksteissä liki sadan vuoden ajan vain painotuserojen muuttuessa hieman. Toivon työni herättävän pohdintaa siitä, mitä saattaisivat olla oman aikamme vastaavanlaiset itsestäänselvyydet, jotka otamme annettuina ja jotka kyseenalaistamattomina totuuksina rajoittavat niin kasvatettavien kuin kasvattajienkin omaksi itsekseen tulemista.