961 resultados para INSTRUMENTATION TECHNIQUES
Resumo:
In this work a method for building multiple-model structures is presented. A clustering algorithm that uses data from the system is employed to define the architecture of the multiple-model, including the size of the region covered by each model, and the number of models. A heating ventilation and air conditioning system is used as a testbed of the proposed method.
Resumo:
In this work a method for building multiple-model structures is presented. A clustering algorithm that uses data from the system is employed to define the architecture of the multiple-model, including the size of the region covered by each model, and the number of models. A heating ventilation and air conditioning system is used as a testbed of the proposed method.
Resumo:
Splitting techniques are commonly used when large-scale models, which appear in different fields of science and engineering, are treated numerically. Four types of splitting procedures are defined and discussed. The problem of the choice of a splitting procedure is investigated. Several numerical tests, by which the influence of the splitting errors on the accuracy of the results is studied, are given. It is shown that the splitting errors decrease linearly when (1) the splitting procedure is of first order and (2) the splitting errors are dominant. Three examples for splitting procedures used in all large-scale air pollution models are presented. Numerical results obtained by a particular air pollution model, Unified Danish Eulerian Model (UNI-DEM), are given and analysed.
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Resumo:
The collection efficiency of two widely used gunshot residue (GSR) collection techniques—carbon-coated adhesive stubs and alcohol swabs—has been compared by counting the number of characteristic GSR particles collected from the firing hand of a shooter after firing one round. Samples were analyzed with both scanning electron microscopy and energy dispersive X-rays by an experienced GSR analyst, and the number of particles on each sample containing Pb, Ba, and Sb counted. The adhesive stubs showed a greater collection efficiency as all 24 samples gave positive results for GSR particles whereas the swabs gave only positive results for half of the 24 samples. Results showed a statistically significant collection efficiency for the stub collection method and likely reasons for this are considered.
Resumo:
This study assesses the current state of adult skeletal age-at-death estimation in biological anthropology through analysis of data published in recent research articles from three major anthropological and archaeological journals (2004–2009). The most commonly used adult ageing methods, age of ‘adulthood’, age ranges and the maximum age reported for ‘mature’ adults were compared. The results showed a wide range of variability in the age at which individuals were determined to be adult (from 14 to 25 years), uneven age ranges, a lack of standardisation in the use of descriptive age categories and the inappropriate application of some ageing methods for the sample being examined. Such discrepancies make comparisons between skeletal samples difficult, while the inappropriate use of some techniques make the resultant age estimations unreliable. At a time when national and even global comparisons of past health are becoming prominent, standardisation in the terminology and age categories used to define adults within each sample is fundamental. It is hoped that this research will prompt discussions in the osteological community (both nationally and internationally) about what defines an ‘adult’, how to standardise the age ranges that we use and how individuals should be assigned to each age category. Skeletal markers have been proposed to help physically identify ‘adult’ individuals.