A agropecuária e os aldeamentos indígenas goianos

A decadência da mineração e o início da ruralização da sociedade. A política pombalina e a retomada doe aldeamentos oficiais. A segunda fase dos aldeamenlos: São José de Mossâmedes, Nova Maria I, Carretão, Salinas ou Boa Vista e Estiva. O indígena e o capitalismo comercial em Goiás nos séculos XVIII e XIX.

Cultura do quiabo submetida a lâminas de irrigação por gotejamento em função da evaporação em tanque Classe A

Pós-graduação em Agronomia (Irrigação e Drenagem) - FCA

Produção de frutos e características morfofisiológicas de Schinus terebinthifolius Raddi., na região do baixo São Francisco, Brasil

Forest species with economic potential, such as aroeira (Schinus terebinthifolius Raddi.), require selection of individuals with superior characteristics for use in forest restoration projects and for establishment of commercial plantations. These plantations can contribute to the sustainability of natural populations of species in the remaining forest fragments, in areas of permanent preservation, legal reserves or other areas of ecological significance. It was evaluated the fruits' yield, morphometry and viability of seeds from 15 individuals of aroeira, collected in different fragments in the region of Lower São Francisco river, Sergipe State. The fruit yield was estimated by Fornier's intensity index, and the morphometric characteristics were obtained with a digital paquimeter and analytical balance. The viability and vigor were evaluated by germination percentage and germination speed index (GSI), under controlled conditions. The results of fruit yield were subjected to variance analysis, and the means were compared by Tukey (p <0.05). The other variables means were compared by Scott-Knott test (p<0.05). The individuals differed in Fournier's indices (indices 1, 2, 3 and 4) and in the size of fruits and seeds. The germination varied from 0 to 83% and the GSI from 0.00 to 0.98. The phenotypic differences observed among individuals for fruit yield, and morphophysiological characteristics can be used in forest restoration and establishment of provenances/progenies tests, aiming discrimination of superior material for future commercial plantations.

The influence of resistance exercise with emphasis on specific contractions (concentric vs. eccentric) on muscle strength and post-exercise autonomic modulation: a randomized clinical trial

Contextualização:Ações concêntricas apresentam maior estresse cardiovascular quando comparadas às excêntricas. Entretanto, não se sabe a influência desses tipos de ações no comportamento da modulação autonômica cardíaca durante o processo de recuperação pós-esforço.Objetivo:Comparar o efeito de um treinamento resistido para o grupo extensor do joelho realizado com ênfase concêntrica vs excêntrica sobre a força muscular e a recuperação pós-exercício considerando índices de variabilidade de frequência cardíaca (VFC) em jovens saudáveis.Método:Cento e cinco homens, com idades entre 18 e 30 anos, foram randomizados em quatro grupos: controle concêntrico (CCONC), controle excêntrico (CEXC), treinamento concêntrico (TCONC) e treinamento excêntrico (TEXC). Os grupos CCONC e CEXC realizaram uma sessão de exercício reduzido (ER) para o grupo extensor do joelho [três séries de uma repetição a 100% de uma repetição máxima (1RM)], e os grupos TCONC e TEXC realizaram dez sessões de treinamento. A VFC foi analisada no momento basal e na recuperação após as sessões (T1, T2, T3 e T4).Resultados:Observou-se aumento da força muscular para o grupo TEXC. Em relação à modulação autonômica cardíaca, observou-se, em comparação ao momento basal, aumento dos índices SDNN e SD2 no momento T1 nos grupos CCONC e CEXC e aumento dos índices RMSSD, SD1 e AF (ms2) nos momentos T1, T2 e T4 no grupo TEXC.Conclusões:Conclui-se que o treinamento resistido realizado com ênfase em contrações excêntricas promoveu ganho de força e aumento da modulação vagal cardíaca durante o processo de recuperação em relação à condição basal.

Protocolos de indução e sincronização do estro em ovelhas

O objetivo do presente trabalho foi testar a indução e sincronização do estro em ovelhas utilizando-se diferentes períodos de permanência do progestágeno, dose única de PGF2α ou efeito macho. Para tanto dois experimentos foram realizados: no experimento 1, as ovelhas (n=48) receberam esponjas vaginais impregnadas com MAP (medroxiprogesterona) e foram divididas em 2 grupos: G-9 e G-14, ou seja, MAP por nove ou 14 dias com aplicação de PGF2α na retirada do progestágeno e detecção de estro com reprodutores. Não houve diferenças (p<0,05) na manifestação no estro (69,6 % e 80%), na porcentagem de prenhez (34,8% e 44%) ou de concepção (50% e 55%) nos grupos G-9 e G-14, respectivamente. No experimento 2, as ovelhas (n=151) foram aleatoriamente divididas em 3 grupos: G-6, cada ovelha recebeu MAP por seis dias e aplicação de PGF2α na retirada do progestágeno; G-PGF, cada ovelha recebeu dose única de PGF2α e G-EM para avaliar o efeito macho foram introduzidos machos entre ovelhas previamente separadas dos mesmos. A porcentagem de manifestação de estro foi maior (p<0,05) nos grupos G-6 (58%) e G-PGF (39%) quando comparados ao G-EM (11%). Concluímos ser possível diminuir o tempo de permanência do progestágeno, porém o uso de luteolítico, em período de transição da estacionalidade reprodutiva, sem o progestágeno, resulta em baixa manifestação de estro.

Substituição da farinha de peixe por farinha de vísceras de aves na alimentação do piavuçu Leporinus macrocephalus

The present study aimed at evaluating the productive performance of Leporinus macrocephalus fed with different levels of inclusion of poultry viscera meal replacing fish meal. The experiment was conducted in a stove located in the Universidade Estadual do Oeste do Paraná during 45 days. We used 200 fish with average initial length of 4.7 ± 0.37 cm and average initial weight of 1.407 ± 0.03 g, distributed in 20 net-cages. The experimental design was randomized with five treatments and five replicates with five levels of replacement of fish meal by poultry viscera meal (0, 25, 50, 75, 100%). The parameters evaluated were the productive performance and the chemical composition of animals. The inclusion of poultry viscera meal in the substitution of fish meal in the feeding of Leporinus macrocephalus can be used without impairing the performance of the animals.

Avaliação da eficácia de crioprotetores permeantes e não permeantes no descongelamento rápido e lento do sêmen canino

The aim of this study was to evaluate the association between cryoprotectants little studied in Brazil such as dimethylformamide and trehalose amid thinner, using protocols of fast and slow defrosting. Three adult Labrador Retrievier male, healthy dogs, weekly submitted to one semen collection during five-weeks period, were used. The base diluent medium used in this study was tris-citrate added with 3% of dimethylformamide + 3% glycerol (D1), 3% dimethylformamide and trehalose (D2) and 4% glycerol (D3). At defrosting, half of the semen samples from each diluent medium was defrosted by rapid method in water-bath at 75 °C for seven minutes, followed by a new immersion at 37 °C for 1 minute. The other half of the samples was defrosted by slow method, in water-bath at 37 °C for 1 minute. The semen was evaluated for sperm progressive motility and vigor, besides membrane integrity. For this, the semen samples were submitted to either hyposmotic and membrane integrity tests of the plasmatic membrane and acrosome (fluorescence). The results indicated that the use of glycerol as cryoprotector in TRIS diluter provides greater efficacy in cryopreserving spermatozoa of the canine species, when compared to dimethylformamide associated with trehalose or glycerol.

Descrição do plexo braquial do cachorro-do-mato (Cerdocyon thous Linnaeus, 1766)

The Cerdocyon thous is a canid that has a wide distribution in South America and, besides some general aspects, its morphology is little known in the literature, especially regarding the nervous system. With the aim of elucidating the anatomical composition of brachial plexus, we studied three male specimens from Paragominas-PA, donated to the Morphological Laboratory of Animal Research (LaPMA), Federal Rural University of Amazonia (UFRA), after death by trampling. The animals were fixed in an aqueous solution of 10% formaldehyde for bilateral dissection of the origin of the brachial plexus. The brachial plexus of C. thous is derived from the last three cervical nerves and the first thoracic nerve (C6-T1). The main nerves that compose it, with their respective origins were the suprascapular nerve, subscapular nerve and musculocutaneous nerve (C6-C7), axillary nerve (C7-C8), radial nerve (C7-T1 and C7-C8), median nerve, ulnar nerve, thoracodorsal and thoracic lateral nerve (C8-T1). We conclude that the brachial plexus of C. thous is similar to that described for the domestic dogs, showing small differences in the composition of some nerves.

Emissão de CO2, características do dossel e acúmulo de forragem em pastos de capim-pensacola sob frequências de desfolhação

The aim of this study was to evaluate CO2 emission, canopy characteristics and herbage accumulation in pastures of pensacola bahiagrass under frequencies of defoliation. The experiment was conducted at the Universidade Estadual Paulista Julio de Mesquita Filho, Faculty of Agrarian Sciences and Veterinary of UNESP, Jaboticabal, São Paulo, Brasil. The experimental period was from May 3rd to July 26th 2012. The experimental area comprised 28 m² of pensacola bahiagrass (Paspalum notatum Flügge), divided into 10 plots for allocation of treatment (frequencies of defoliation = 2 or 4 weeks). The following variables were studied: canopy height, light interception, leaf area index, herbage accumulation, tiller density, CO2 emissions, soil temperature and moisture. The frequencies of defoliation in the months of May, June and July slightly affect pensacola bahiagrass characteristics. CO2, soil temperature and moisture are more associated to environmental conditions (months of evaluation) than to the frequencies of defoliation imposed to the canopies.

uPAR expression in canine normal prostate and with proliferative disorders

Prostatic lesions such as prostatic intraepithelial neoplasia (PIN) and proliferative inflammatory atrophy (PIA) are studied in human and canine species due to their malignance potential. The plasminogen activator (PA) system has been suggested to play a central role in cell adhesion, angiogenesis, inflammation, and tumor invasion. The urokinase-type plasminogen activator receptor (uPAR) is a component of the PA, with a range of expression in tumor and stromal cells. In this study, uPAR expression in both canine normal prostates and with proliferative disorders (benign prostatic hyperplasia-BPH, proliferative inflammatory atrophy-PIA, prostatic intraepithelial neoplasia-PIN, and carcinoma-PC) was evaluated by immunohistochemistry in a tissue microarray (TMA) slide to establish the role of this enzyme in extracellular matrix (ECM) remodeling and in the processes of tissue invasion. A total of 298 cores and 355 diagnoses were obtained, with 36 (10.1%) normal prostates, 46 (13.0%) with BPH, 128 (36.1%) with PIA, 74 (20.8%) with PIN and 71 (20.0%) with PC. There is variation in the expression of uPAR in canine prostate according to the lesion, with lower expression in normal tissue and with BPH, and higher expression in tissue with PIA, PIN and PC. The high expression of uPAR in inflammatory and neoplastic microenvironment indicates increased proteolytic activity in canine prostates with PIA, PIN, and PC.

Avaliação sorológica de Parainfluenzavirus Tipo 1, Salmonella spp., Mycoplasma spp. e Toxoplasma gondii em aves silvestres

Newcastle disease, salmonellosis and mycoplamosis are the most important infectious diseases in poultry. Toxoplamosis is a common disease in urban environment. The present study investigated serologic evidence of these diseases in captive and wildlife birds, with rapid plate agglutination test, haemagglutination inhibition test, and modified agglutination test. In a total of 117 blood serum samples, 20 showed the presence of Toxoplasma gondii, Mycoplasma gallisepticum, and Salmonella spp. antibodies. Amazona aestiva was the specie with the highest number of positive individuals (13/20). We also verified the first detection of T. gondii antibodies in birds of prey from Mivalgo chimachima and Rupornis magnirostris species.

Avaliação da somatotropina bovina recombinante (rbST) nos não-componentes da carcaça de cabritos de três genótipos

This study was developed with the aim of evaluating recombinant bovine somatotropin (rbST) on non-carcass components of goat kids of three genotypes. It was used 23 male goat kids of three genotypes, being 8 Alpine, 4 ½ Boer + ½ Alpine (½ BA) and 11 ¾ Boer + ¼Alpine (¾ BA), from which 12 received rbST e 11 control. The growth hormone used was the recombinant bovine somatotropin (rbST) and animals of treatment 1 received the hormone in the amount of 0.3 mg/kg live weight, from 45 days, adjusted in intervals of 14 days. Animals of treatment 2 (control) received saline solution in the same dosage and interval. The ½ BA goats presented a higher proportion of external non-carcass components (head, feet and skin) in relation to Alpine goats. Regarding the vital organs, such as lungs, kidneys and spleen, and the non-carcass components blood, internal fat and perinephric fat, Alpine goats presented higher values than ¾ BA goats. The administration of recombinant bovine somatotropin (rbST) did not produce effect on proportions and weight of non-carcass components. Proportions and weight of non-carcass components varied in function of genotypes, although animals were slaughtered at similar live weight.

Comparação das características e medidas ultrassonográficas das glândulas adrenais de cães e gatos filhotes saudáveis

The aim of the study was to analyze and compare the ultrasound characteristics of adrenal glands between healthy puppies and kittens by establishing standards of normality and references. Fifteen healthy crossbred puppies with mean weight of 3 kg and fifteen healthy crossbred kittens with mean weight of 2 kg, aged between five and six months, participated in the study. The animals were submitted to ultrasound exam of adrenal glands for visualization of their internal characteristics. The frequency of visualization of adrenal glands was 100% in kittens. In puppies the frequency was 75% for the right gland and 100% for the left gland. The puppy's adrenal gland, both right and left, were bigger in length (1.08 ± 0.01 cm, 1.11 ± 0.01 cm) and width (0.42 ± 0.02 cm, 0.45 ± 0.01 cm) in relation to kittens' adrenal gland length (0.64 ± 0.01 cm, 0.63 ± 0.01 cm) and width (0.30 ± 0.02 cm, 0.34 ± 0.01 cm). The adrenal gland of puppies and kittens was hypoechogenic to the surrounded fat, delimited by a hyperechogenic line and without distinction of the cortical and medullar region. The ultrasound dimensions of length and width of the adrenal glands, both right and left, were the same in puppies and kittens. The right and left puppies' adrenal glands were longer and wider than the kittens' glands.

Avanços na criopreservação do sêmen ovino I: diluidores e crioprotetores

The effectiveness of using frozen sheep semen in artificial insemination programs requires the development of extenders and freezing protocols that will increase pregnancy rate of inseminated females. This work aimed to survey the main extenders, additives and external and internal cryoprotectants that have been employed to improve the maintenance levels of sperm parameters after the freezing-thawing process. Better rates of post-thawing sheep sperm viability may be obtained with changes in the freezing extender composition, whether by the adjustment of its components or by introducing additives that inhibit the occurrence of sperm changes during the cryopreservation process. Thus, the possible changes proposed must take into consideration the intrinsic characteristics of ram semen and the individual variability among animals. It is important to emphasize that the sperm cryopreservation effectiveness requires that all process steps are conducted in an integrated manner, to maximize the fertility rate of frozen ram semen.

PCR fluorescente associada à eletroforese capilar como ferramenta de diagnóstico de bactérias no semen

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.