996 resultados para DNA array
Resumo:
In order to contribute to the debate about southern glacial refugia used by temperate species and more northern refugia used by boreal or cold-temperate species, we examined the phylogeography of a widespread snake species (Vipera berus) inhabiting Europe up to the Arctic Circle. The analysis of the mitochondrial DNA (mtDNA) sequence variation in 1043 bp of the cytochrome b gene and in 918 bp of the noncoding control region was performed with phylogenetic approaches. Our results suggest that both the duplicated control region and cytochrome b evolve at a similar rate in this species. Phylogenetic analysis showed that V. berus is divided into three major mitochondrial lineages, probably resulting from an Italian, a Balkan and a Northern (from France to Russia) refugial area in Eastern Europe, near the Carpathian Mountains. In addition, the Northern clade presents an important substructure, suggesting two sequential colonization events in Europe. First, the continent was colonized from the three main refugial areas mentioned above during the Lower-Mid Pleistocene. Second, recolonization of most of Europe most likely originated from several refugia located outside of the Mediterranean peninsulas (Carpathian region, east of the Carpathians, France and possibly Hungary) during the Mid-Late Pleistocene, while populations within the Italian and Balkan Peninsulas fluctuated only slightly in distribution range, with larger lowland populations during glacial times and with refugial mountain populations during interglacials, as in the present time. The phylogeographical structure revealed in our study suggests complex recolonization dynamics of the European continent by V. berus, characterized by latitudinal as well as altitudinal range shifts, driven by both climatic changes and competition with related species.
Resumo:
GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.
Resumo:
Kirjoitus on lisäys professorien Olli Halkan ja Veikko Sorsan artikkeleihin TT -lehdessä 2 ja 3/2004.
Resumo:
Vastine Olli Halkan kirjoitukseen TT -lehdessä 2/2004
Resumo:
Vastine TT -lehden numerossa 8/2003 olleeseen Jani Rydmanin kommenttiin Pekkan Nuortevan Luonnon tutkijassa olleeseen artikkeliin
Resumo:
Epigenetic silencing of the DNA repair protein O(6)-methylguanine-DNA methyltransferase (MGMT) by promoter methylation predicts successful alkylating agent therapy, such as with temozolomide, in glioblastoma patients. Stratified therapy assignment of patients in prospective clinical trials according to tumor MGMT status requires a standardized diagnostic test, suitable for high-throughput analysis of small amounts of formalin-fixed, paraffin-embedded tumor tissue. A direct, real-time methylation-specific PCR (MSP) assay was developed to determine methylation status of the MGMT gene promoter. Assay specificity was obtained by selective amplification of methylated DNA sequences of sodium bisulfite-modified DNA. The copy number of the methylated MGMT promoter, normalized to the beta-actin gene, provides a quantitative test result. We analyzed 134 clinical glioma samples, comparing the new test with the previously validated nested gel-based MSP assay, which yields a binary readout. A cut-off value for the MGMT methylation status was suggested by fitting a bimodal normal mixture model to the real-time results, supporting the hypothesis that there are two distinct populations within the test samples. Comparison of the tests showed high concordance of the results (82/91 [90%]; Cohen's kappa = 0.80; 95% confidence interval, 0.82-0.95). The direct, real-time MSP assay was highly reproducible (Pearson correlation 0.996) and showed valid test results for 93% (125/134) of samples compared with 75% (94/125) for the nested, gel-based MSP assay. This high-throughput test provides an important pharmacogenomic tool for individualized management of alkylating agent chemotherapy.
Resumo:
A general understanding of interactions between DNA andoppositely charged compounds forms the basis for developing novelDNA-based materials, including gel particles. The association strength,which is altered by varying the chemical structure of the cationiccosolute, determines the spatial homogeneity of the gelation process,creating DNA reservoir devices and DNA matrix devices that can bedesigned to release either single- (ssDNA) or double-stranded(dsDNA) DNA. This paper reviews the preparation of DNA gelparticles using surfactants, proteins and polysaccharides. Particlemorphology, swelling/dissolution behaviour, degree of DNAentrapment and DNA release responses as a function of the nature ofthe cationic agent used are discussed. Current directions in thehaemocompatible and cytotoxic characterization of these DNA gelparticles have been also included.
Resumo:
BACKGROUND: To understand cancer-related modifications to transcriptional programs requires detailed knowledge about the activation of signal-transduction pathways and gene expression programs. To investigate the mechanisms of target gene regulation by human estrogen receptor alpha (hERalpha), we combine extensive location and expression datasets with genomic sequence analysis. In particular, we study the influence of patterns of DNA occupancy by hERalpha on expression phenotypes. RESULTS: We find that strong ChIP-chip sites co-localize with strong hERalpha consensus sites and detect nucleotide bias near hERalpha sites. The localization of ChIP-chip sites relative to annotated genes shows that weak sites are enriched near transcription start sites, while stronger sites show no positional bias. Assessing the relationship between binding configurations and expression phenotypes, we find binding sites downstream of the transcription start site (TSS) to be equally good or better predictors of hERalpha-mediated expression as upstream sites. The study of FOX and SP1 cofactor sites near hERalpha ChIP sites shows that induced genes frequently have FOX or SP1 sites. Finally we integrate these multiple datasets to define a high confidence set of primary hERalpha target genes. CONCLUSION: Our results support the model of long-range interactions of hERalpha with the promoter-bound cofactor SP1 residing at the promoter of hERalpha target genes. FOX motifs co-occur with hERalpha motifs along responsive genes. Importantly we show that the spatial arrangement of sites near the start sites and within the full transcript is important in determining response to estrogen signaling.
Resumo:
Owl pellets contain a good skeletal record of the small mammals consumed, and correspond to the undigested portions of prey which are regurgitated. These pellets are easy to find at the roosting site of owls. As it has been demonstrated that amplifiable DNA can be isolated from ancient bone remains, the possibility of using owl pellets as a source of DNA for small mammal genetics studies via the polymerase chain reaction has been investigated. The main uncertainties when isolating DNA from such a material are firstly the possibility that the extracted DNA would be too degraded during the digestion in the stomach of the owl, and secondly that extensive cross-contaminations could occur among the different prey consumed. The results obtained clearly demonstrate that cross-contamination does not occur, and that mitochondrial and nuclear DNA can be amplified using skulls of small mammals found in owl pellets as a source of DNA. The relative efficiency of two methods of DNA extraction is estimated and discussed. Thus, owl pellets represent a non-invasive sampling technique which provides a valuable source of DNA for studying population genetics of small mammals.
Resumo:
Résumé Une caractéristique des cellules eucaryotes est le confinement du matériel génétique (ADN/DNA) dans le noyau. Pour décoder cette information, un ARN messager (mRNA) est d'abord transcrit sous forme d'un ARN prémessager (pré-mRNA). Ce-dernier doit subir plusieurs étapes de maturation pour aboutir à une particule ribonucléoprotéique (mRNP) qui sera exportée vers le cytoplasme et traduite en protéine. La protéine de levure Mex67p et son homologue humain TAP sont des récepteurs d'export médiant la translocation du mRNP au travers des complexes du pore nucléaire (NPC). Mex67p/TAP ne se lient pas directement au mRNA, mais nécessitent la présence de protéines adaptatrices, telles que Yra1p et son homologue humain REF1. Afin d'identifier de nouveaux facteurs impliqués dans l'export des mRNPs ou de nouvelles fonctions pour Yra1p, nous avons effectué un crible génétique avec un mutant thermosensible de Yra1p, GFP-yra 1 -8. Ce mutant présente un défaut d'export des mRNAs et une diminution des niveaux de transcrits du gène rapporteur LacZ ainsi que de certains transcrits endogènes. Nous avons trouvé que la perte de Mlp2p, ou d'une protéine hautement similaire, Mlp1p, restaure la croissance du mutant GFP-yra1-8 à température restrictive. Mlp1p et Mlp2p sont des protéines nucléaires, dont l'homologue humain est TPR. Les Mlp (myosin¬like proteins) ainsi que TPR forment des structures filamenteuses ancrées aux NPC. Bien que la fonction des Mlp ne soit pas clairement définie, un rôle dans la biogenèse et la surveillance des mRNPs a été récemment proposé. Notre étude montre que la perte des Mlp, non seulement restaure la croissance de GFP-yra1-8, mais augmente aussi les niveaux des transcrits LacZ et facilite leur apparition dans le cytoplasme. Des expériences d'immunoprécipitations de la chromatine révèlent que Mlp2p diminue le taux de synthèse du transcrit LacZ dans GFP-yra1-8. Des analyses du transcriptome montrent que Mlp2p réduit aussi les niveaux d'une population de transcrits endogènes dans le mutant. Finalement, des localisations in situ suggèrent que la transcription du rapporteur LacZ a lieu à la périphérie du noyau, à proximité des Mlp. Ainsi, les protéines Mlp pourraient préférentiellement diminuer la transcription de gènes exprimés à la périphérie nucléaire. Nous montrons aussi que Yra1p interagit génétiquement avec Nab2p une protéine liée au mRNA et impliquée dans son export, mais non avec d'autres protéines également impliquées dans l'export des mRNAs. Les résultats obtenus soutiennent un modèle où les protéines Yra1p et Nab2p sont nécessaires à l'arrimage des mRNPs sur la plate-forme des Mlp. Si ces signaux manquent ou sont défectueux, les mRNPs ne peuvent pas poursuivre leur trajet vers le canal central du NPC. Ce bloc induirait par la suite une diminution de la transcription d'une population de gènes potentiellement localisée à la périphérie nucléaire. Dans son ensemble, cette étude suggère que les protéines Mlp établissent un lien entre la transcription de certains mRNAs et leur export au travers du pore nucléaire. Summary A hallmark of the eukaryotic cell is the packaging of DNA in the nucleus. To decode the genetic information, a messenger RNA (mRNA) is first synthesized as a pre-mRNA molecule, which undergoes different maturation steps resulting in an mRNP (messenger RNA ribonucleoprotein), which can be actively transported to the cytoplasm and translated into a protein. Yeast Mex67p and its human homologue TAP are export receptors mediating mRNP translocation through the nuclear pore complex (NPC). The recruitment of Mex67p/TAP to mRNA is mediated by mRNA export adaptors of the evolutionarily conserved REF (RNA and Export Factor binding) family: yeast Yra1p and human REF1. To uncover new functions of Yra1p or new factors implicated in mRNA export, we performed a genetic screen with a themiosensitive (ts) yra1 mutant, GFP-yra1-8. This mutant exhibits mRNA export defects and a decrease in the levels of LacZ reporter and certain endogenous transcripts. We found that the loss of Mlp2p, or the related Mlp1p protein, substantially rescues the growth defect of the GFP-yra1 -8 mutant. Mlp1p and M1p2p are large non-essential proteins, homologous to human TPR, proposed to form intra-nuclear filamentous structures anchored at the NPC. Their role is not clearly defined, but they have been implicated in mRNP biogenesis and surveillance. Our study shows that loss of Mlp proteins not only restores growth of GFP-yra1-8, but also rescues LacZ mRNA levels and increases their appearance in the cytoplasm. Chromatin immunoprecipitation and pulse chase experiments indicate that Mlp2p down-regulates LacZ mRNA synthesis in GFP-yra1-8. DNA micro- array analyses reveal that Mlp2p also reduces the levels of a subset of cellular transcripts in the yra1 mutant strain. In situ localizations suggest that LacZ transcription occurs at the nuclear periphery, in close proximity to Mlp proteins. Thus, Mlp proteins may preferentially down-regulate genes expressed at the nuclear periphery. Finally, we show that Yra1p genetically interacts with the shuttling mRNA-binding protein Nab2p and that loss of Mlp proteins rescues the growth defect of yra1 and nab2, but not other mRNA export mutants. The data support a model in which Nab2p and Yra1p are required for rnRNP docking to the Mlp platform. Lack of these signals prevents mRNPs from crossing the Mlp gate. This block may then negatively feed-back on the transcription of a subset of genes, potentially located at the nuclear envelope. Overall, this study suggests that perinuclear Mlp proteins establish a link between mRNA transcription and export.
Resumo:
The intracellular location of nucleic acid sensors prevents recognition of extracellular self-DNA released by dying cells. However, on forming a complex with the endogenous antimicrobial peptide LL37, extracellular DNA is transported into endosomal compartments of plasmacytoid dendritic cells, leading to activation of Toll-like receptor-9 and induction of type I IFNs. Whether LL37 also transports self-DNA into nonplasmacytoid dendritic cells, leading to type I IFN production via other intracellular DNA receptors is unknown. Here we found that LL37 very efficiently transports self-DNA into monocytes, leading the production of type I IFNs in a Toll-like receptor-independent manner. This type I IFN induction was mediated by double-stranded B form DNA, regardless of its sequence, CpG content, or methylation status, and required signaling through the adaptor protein STING and TBK1 kinase, indicating the involvement of cytosolic DNA sensors. Thus, our study identifies a novel link between the antimicrobial peptides and type I IFN responses involving DNA-dependent activation of cytosolic sensors in monocytes.
Resumo:
PURPOSE: Congenital stationary night blindness (CSNB) is a clinically and genetically heterogeneous retinal disease. Although electroretinographic (ERG) measurements can discriminate clinical subgroups, the identification of the underlying genetic defects has been complicated for CSNB because of genetic heterogeneity, the uncertainty about the mode of inheritance, and time-consuming and costly mutation scanning and direct sequencing approaches. METHODS: To overcome these challenges and to generate a time- and cost-efficient mutation screening tool, the authors developed a CSNB genotyping microarray with arrayed primer extension (APEX) technology. To cover as many mutations as possible, a comprehensive literature search was performed, and DNA samples from a cohort of patients with CSNB were first sequenced directly in known CSNB genes. Subsequently, oligonucleotides were designed representing 126 sequence variations in RHO, CABP4, CACNA1F, CACNA2D4, GNAT1, GRM6, NYX, PDE6B, and SAG and spotted on the chip. RESULTS: Direct sequencing of genes known to be associated with CSNB in the study cohort revealed 21 mutations (12 novel and 9 previously reported). The resultant microarray containing oligonucleotides, which allow to detect 126 known and novel mutations, was 100% effective in determining the expected sequence changes in all known samples assessed. In addition, investigation of 34 patients with CSNB who were previously not genotyped revealed sequence variants in 18%, of which 15% are thought to be disease-causing mutations. CONCLUSIONS: This relatively inexpensive first-pass genetic testing device for patients with a diagnosis of CSNB will improve molecular diagnostics and genetic counseling of patients and their families and gives the opportunity to analyze whether, for example, more progressive disorders such as cone or cone-rod dystrophies underlie the same gene defects.
Resumo:
Wolfram syndrome is a progressive neurodegenerative disorder transmitted in an autosomal recessive mode. We report two Wolfram syndrome families harboring multiple deletions of mitochondrial DNA. The deletions reached percentages as high as 85-90% in affected tissues such as the central nervous system of one patient, while in other tissues from the same patient and from other members of the family, the percentages of deleted mitochondrial DNA genomes were only 1-10%. Recently, a Wolfram syndrome gene has been linked to markers on 4p16. In both families linkage between the disease locus and 4p16 markers gave a maximum multipoint lod score of 3.79 at theta = 0 (Pi<0.03) with respect to D4S431. In these families, the syndrome was caused by mutations in this nucleus-encoded gene which deleteriously interacts with the mitochondrial genome. This is the first evidence of the implication of both genomes in a recessive disease.
Resumo:
Wolfram syndrome is a progressive neurodegenerative disorder transmitted in an autosomal recessive mode. We report two Wolfram syndrome families harboring multiple deletions of mitochondrial DNA. The deletions reached percentages as high as 85-90% in affected tissues such as the central nervous system of one patient, while in other tissues from the same patient and from other members of the family, the percentages of deleted mitochondrial DNA genomes were only 1-10%. Recently, a Wolfram syndrome gene has been linked to markers on 4p16. In both families linkage between the disease locus and 4p16 markers gave a maximum multipoint lod score of 3.79 at theta = 0 (Pi<0.03) with respect to D4S431. In these families, the syndrome was caused by mutations in this nucleus-encoded gene which deleteriously interacts with the mitochondrial genome. This is the first evidence of the implication of both genomes in a recessive disease.
Resumo:
PURPOSE: To assess the usefulness of combining hyperthermia with a DNA repair inhibitor (double-strand break bait [Dbait]) and its potential application to radiofrequency ablation (RFA) in a preclinical model of human colorectal cancer. MATERIALS AND METHODS: The local ethics committee of animal experimentation approved all investigations. First, the relevance was assessed by studying the survival of four human colorectal adenocarcinoma cell cultures after 1 hour of hyperthermia at 41°C or 43°C with or without Dbait. Human colon adenocarcinoma cells (HT-29) were grafted subcutaneously into nude mice (n = 111). When tumors reached approximately 500 mm(3), mice were treated with Dbait alone (n = 20), sublethal RFA (n = 21), three different Dbait schemes and sublethal RFA (n = 52), or a sham treatment (n = 18). RFA was performed to ablate the tumor center alone. To elucidate antitumor mechanisms, 39 mice were sacrificed for blinded pathologic analysis, including assessment of DNA damage, cell proliferation, and tumor necrosis. Others were monitored for tumor growth and survival. Analyses of variance and log-rank tests were used to evaluate differences. RESULTS: When associated with mild hyperthermia, Dbait induced cytotoxicity in all tested colon cancer cell lines. Sublethal RFA or Dbait treatment alone moderately improved survival (median, 40 days vs 28 days for control; P = .0005) but combination treatment significantly improved survival (median, 84 days vs 40 days for RFA alone, P = .0004), with approximately half of the animals showing complete tumor responses. Pathologic studies showed that the Dbait and RFA combination strongly enhances DNA damage and coagulation areas in tumors. CONCLUSION: Combining Dbait with RFA sensitizes the tumor periphery to mild hyperthermia and increases RFA antitumor efficacy.