Possibility to add a barrier layer to a fibre tray package in the moulding stage

The main objective of the present study was to analyze the best approach on how to coat paperboard trays at the pressing stage. The coating gives the paperboard enhanced barrier and mechanical properties. The whole process chain of the barrier coating development was studied in the research. The methodology applied includes obtaining the optimum temperature at which good adhesion and bonding is formed between paperboard and skin film. Evaluation of mechanical properties after the coatings; such as cracking, curling and barrier properties was performed.

Dual light barrier method for six degrees of freedom tool center point calibration of an industrial robot

Tool center point calibration is a known problem in industrial robotics. The major focus of academic research is to enhance the accuracy and repeatability of next generation robots. However, operators of currently available robots are working within the limits of the robot´s repeatability and require calibration methods suitable for these basic applications. This study was conducted in association with Stresstech Oy, which provides solutions for manufacturing quality control. Their sensor, based on the Barkhausen noise effect, requires accurate positioning. The accuracy requirement admits a tool center point calibration problem if measurements are executed with an industrial robot. Multiple possibilities are available in the market for automatic tool center point calibration. Manufacturers provide customized calibrators to most robot types and tools. With the handmade sensors and multiple robot types that Stresstech uses, this would require great deal of labor. This thesis introduces a calibration method that is suitable for all robots which have two digital input ports free. It functions with the traditional method of using a light barrier to detect the tool in the robot coordinate system. However, this method utilizes two parallel light barriers to simultaneously measure and detect the center axis of the tool. Rotations about two axes are defined with the center axis. The last rotation about the Z-axis is calculated for tools that have different width of X- and Y-axes. The results indicate that this method is suitable for calibrating the geometric tool center point of a Barkhausen noise sensor. In the repeatability tests, a standard deviation inside robot repeatability was acquired. The Barkhausen noise signal was also evaluated after recalibration and the results indicate correct calibration. However, future studies should be conducted using a more accurate manipulator, since the method employs the robot itself as a measuring device.

Modeling temporal variations of Gracilaria Greville and Hypnea J.V. Lamouroux (Rhodophyta) assemblages on a midlittoral reef platform at Piedade Beach, Pernambuco State, Brazil

The diversity of algal banks composed of species out the genera Gracilaria Greville and Hypnea J.V. Lamouroux have been impacted by commercial exploitation and coastal eutrophication. The present study sought to construct dynamic models based on algal physiology to simulate seasonal variations in the biomasses of Gracilaria and Hypnea an intertidal reef at Piedade Beach in Jaboatão dos Guararapes, Pernambuco State, Brazil. Five 20 × 20 cm plots in a reef pool on a midlittoral reef platform were randomly sampled during April, June, August, October, and December/2009 and in January and March/2010. Water temperature, pH, irradiance, oxygen and salinity levels as well as the concentrations of ammonia, nitrate and phosphate were measured at the sampling site. Forcing functions were employed in the model to represent abiotic factors, and algal decay was simulated with a dispersal function. Algal growth was modeled using a logistic function and was found to be sensitive to temperature and salinity. Maximum absorption rates of ammonia and phosphate were higher in Hypnea than in Gracilaria, indicating that the former takes up nutrients more efficiently at higher concentrations. Gracilaria biomass peaked at approximately 120 g (dry weight m-2) in March/2010 and was significantly lower in August/2009; Hypnea biomasses, on the other hand, did not show any significant variations among the different months, indicating that resource competition may influence the productivity of these algae.

Inflammatory response of the spinal cord to multiple episodes of blood-brain barrier disruption and toxic demyelination in Wistar rats

Multiple episodes of blood-brain barrier disruption were induced by sequential intraspinal injections of ethidium bromide. In addition to the barrier disruption, there was toxic demyelination and exposure of myelin components to the immune system. Twenty-seven 3-month-old Wistar rats received 2, 3 or 4 injections of 1 µl of either 0.1% ethidium bromide in normal saline (19 rats) or 0.9% saline (8 rats) at different levels of the spinal cord. The time intervals between the injections ranged from 28 to 42 days. Ten days after the last injection, all rats were perfused with 2.5% glutaraldehyde. The spinal sections were evaluated macroscopically and by light and transmission electron microscopy. All the lesions demonstrated a mononuclear phagocytic infiltrate apparently removing myelin. Lymphocytes were not conspicuous and were found in only 34% of the lesions. No perivascular cuffings were detected. In older lesions (38 days and older) they were found only within Virchow-Robin spaces. This result suggests that multiple blood-brain barrier disruptions with demyelination and exposure of myelin components to the immune system were not sufficient to induce an immune-mediated reaction in the central nervous system.

Effect of high hydrostatic pressure on the barrier properties of polyamide-6 films

Little is known about the barrier properties of polymer films during high pressure processing of prepackaged foods. In order to learn more about this, we examined the influence of high hydrostatic pressure on the permeation of raspberry ketone (dissolved in ethanol/water) through polyamide-6 films at temperatures between 20 and 60ºC. Permeation was lowered by increasing pressure at all temperatures. At 23°C, the increasing pressure sequence 0.1, 50, 100, 150, and 200 MPa correlated with the decreasing permeation coefficients P/(10(9) cm² s-1) of 6.2, 3.8, 3.0, 2.2, and 1.6. Analysis of the permeation kinetics indicated that this effect was due to a reduced diffusion coefficient. Pressure and temperature acted antagonistically to each other. The decrease in permeation at 200 MPa was compensated for by a temperature increase of 20ºC. After release of pressure, the former permeation coefficients were recovered, which suggests that this `pressure effect' is reversible. Taken together, our data revealed no detrimental effects of high hydrostatic pressure on the barrier properties of polymer films.

Beneficial effect of recombinant human growth hormone on the intestinal mucosa barrier of septic rats

The objective of the present study was to investigate the effects of recombinant human growth hormone (rhGH) on the intestinal mucosa barrier of septic rats and explore its possible mechanism. Female Sprague-Dawley rats were randomized into three groups: control, Escherichia coli-induced sepsis (S) and treatment (T) groups. Groups S and T were subdivided into subgroups 1d and 3d, respectively. Expression of liver insulin-like growth factor-1 (IGF-1) mRNA, Bcl-2 and Bax protein levels and the intestinal Bax/Bcl-2 ratio, and plasma GH and IGF-1 levels were determined. Histological examination of the intestine was performed and bacterial translocation was determined. rhGH significantly attenuated intestinal mucosal injuries and bacterial translocation in septic rats, markedly decreased Bax protein levels, inhibited the decrease of Bcl-2 protein expression and maintained the Bax/Bcl-2 ratio in the intestine. rhGH given after sepsis significantly improved levels of plasma GH (T1d: 1.28 ± 0.24; T3d: 2.14 ± 0.48 µg/L vs S1d: 0.74 ± 0.12; S3d: 0.60 ± 0.18 µg/L; P < 0.05) and IGF-1 (T1d: 168.94 ± 65.67; T3d: 201.56 ± 64.98 µg/L vs S1d: 116.72 ± 13.96; S3d: 107.50 ± 23.53 µg/L; P < 0.05) and expression of liver IGF-1 mRNA (T1d: 0.98 ± 0.20; T3d: 1.76 ± 0.17 vs S1d: 0.38 ± 0.09; S3d: 0.46 ± 0.10; P < 0.05). These findings indicate that treatment with rhGH had beneficial effects on the maintenance of the integrity of the intestinal mucosa barrier in septic rats.

Tumor necrosis factor alpha increases epithelial barrier permeability by disrupting tight junctions in Caco-2 cells

The objectives of this study were to determine the effect of tumor necrosis factor alpha (TNF-α) on intestinal epithelial cell permeability and the expression of tight junction proteins. Caco-2 cells were plated onto Transwell® microporous filters and treated with TNF-α (10 or 100 ng/mL) for 0, 4, 8, 16, or 24 h. The transepithelial electrical resistance and the mucosal-to-serosal flux rates of the established paracellular marker Lucifer yellow were measured in filter-grown monolayers of Caco-2 intestinal cells. The localization and expression of the tight junction protein occludin were detected by immunofluorescence and Western blot analysis, respectively. SYBR-Green-based real-time PCR was used to measure the expression of occludin mRNA. TNF-α treatment produced concentration- and time-dependent decreases in Caco-2 transepithelial resistance and increases in transepithelial permeability to the paracellular marker Lucifer yellow. Western blot results indicated that TNF-α decreased the expression of phosphorylated occludin in detergent-insoluble fractions but did not affect the expression of non-phosphorylated occludin protein. Real-time RT-PCR data showed that TNF-α did not affect the expression of occludin mRNA. Taken together, our data demonstrate that TNF-α increases Caco-2 monolayer permeability, decreases occludin protein expression and disturbs intercellular junctions.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Functionalisation of spruce O-acetyl-galactoglucomannans for barrier and composite applications

The increasing use of energy, food, and materials by the growing population in the world is leading to the situation where alternative solutions from renewable carbon resources are sought after. The growing use of plastics depends on the raw-oil production while oil refining are politically governed and required for the polymer manufacturing is not sustainable in terms of carbon footprint. The amount of packaging is also increasing. Packaging is not only utilising cardboard and paper, but also plastics. The synthetic petroleum-derived plastics and inner-coatings in food packaging can be substituted with polymeric material from the renewable resources. The trees in Finnish forests constitute a huge resource, which ought to be utilised more effectively than it is today. One underutilised component of the forests is the wood-derived hemicelluloses, although Spruce Oacetyl-galactoglucomannans (GGMs) have previously shown high potential for material applications and can be recovered in large scale. Hemicelluloses are hydrophilic in their native state, which restrains the use of them for food packaging as non-dry item. To cope with this challenge, we intended to make GGMs more hydrophobic or amphiphilic by chemical grafting and consequently with the focus of using them for barrier applications. Methods of esterification with anhydrides and cationic etherification with a trimethyl ammonium moiety were established. A method of controlled synthesis to obtain the desired properties by the means of altering temperature, reaction time, the quantity of the reagent, and even the solvent for purification of the products was developed. Numerous analytical tools, such as NMR, FTIR, SEC-MALLS/RI, MALDI-TOF-MS, RP-HPLC and polyelectrolyte titration were used to evaluate the products from different perspectives and to acquire parallel proofs of their chemical structure. Modified GGMs with different degree of substitution and the correlating level of hydrophobicity was applied as coatings on cartonboard and on nanofibrillated cellulose-GGM films to exhibit barrier functionality. The water dispersibility in processing was maintained with GGM esters with low DS. The use of chemically functionalised GGM was evaluated for the use as barriers against water, oxygen and grease for the food packaging purposes. The results show undoubtedly that GGM derivatives exhibit high potential to function as a barrier material in food packaging.

Compte rendu des maladies observées et des opérations pratiquées à l'Hôtel-Dieu de Lyon pendant l'année 1850, dans le service de M. Barrier,...

Comprend : Réflexions

Sedimentology of the Sixteen Mile Creek Lagoon, Niagara Peninsula, Ontario, Canada

The effec s of relative water level changes in Lake Ontario were detected in the ysical, chemical and biological characteristics of the sediments of the Fifteen, Sixteen and Twenty Mile Creek lagoonal complexes. Regional environmental changes have occurred resulting in the following sequence of sediments in the three lagoons and marsh. From the base up they are; (I) Till,(2) Pink Clay, (3) Bottom Sand, (4) Gyttja, (5) Orange Sandy Silt, (6) Brown Clay and (7) Gray Clay. The till was only encountered in the marsh and channel; however, it is presumed to occur throughout the entire area. The presence of diatoms and sponge spicules, the vertical and ongitudinal uniformity of the sediment and the stratigr ic position of the Pink Clay indicate that it has a glacial or post-glacial lacustrine origin. Overl ng the Pink Clay or Till is a clayey, silty sand to gravel. The downstream fining and unsorted nature of this material indicate that it has a fluvial/deltaic origin. Water levels began rising in the lagoon 3,250 years ago resulting in the deposition of the Gyttja, a brown, organic-rich silty clay probably deposited in a shallow, stagnant environment as shown by the presence of pyrite in the organic material and relatively high proportions of benthic diatoms and grass pollen. Increase in the rate of deposition of the Gyttja on Twenty Mile Creek and a decrease in the same unit on Sixteen Mile Creek is possibly the result of a capture of the Sixteen Mile Creek by the Twenty Mile Creek. The rise in lake level responsible for the onset and transgression of this III unit may have been produced by isostatic rebound; however, the deposition also corresponds closely to a drop in the level of Lake Huron and increased flow through the lower lakes. The o ange Sandy Silt, present only in the marsh, appears to be a buried soil horizon as shown by oxidized roots, and may be the upland equivalant to the Gyttja. Additional deepening resulted in the deposition of Brown Clay, a unit which only occurs at the lakeward end of the three lagoons. The decrease in grass pollen and the relatively high proportion of pelagic diatoms are evidence for this. The deepening may be the result of isostatic rebound; however, the onset of its deposition at 1640 years B.P. is synchronous in the three lagoons and corresponds to the end of the subAtlantic climatic episode. The effects of the climatic change in southern Ontario is uncertain. Average deposition rates of the Brown Clay are similar to those in the upper Gyttja on Sixteen Mile Creek; however, Twenty Mile Creek shows lower rates of the Brown Clay than those in the upper Gyttja. The Gray Clay covers the present bottom of the three lagoons and also occurs in the marsh It is inter1aminated wi sand in the channels. Increases in the rates of deposi ion, high concentrations of Ca and Zn, an Ambrosia rise, and an increase in bioturbation possibly due to the activities of the carp, indicate th this unit is a recent deposit resulting from the activities of man.

The importance of the Hedgehog signaling pathway at the level of the blood-brain barrier

La barrière hémato-encéphalique (BHE) protège le système nerveux central (SNC) en contrôlant le passage des substances sanguines et des cellules immunitaires. La BHE est formée de cellules endothéliales liées ensemble par des jonctions serrées et ses fonctions sont maintenues par des astrocytes, celles ci sécrétant un nombre de facteurs essentiels. Une analyse protéomique de radeaux lipidiques de cellules endothéliales de la BHE humaine a identifié la présence de la voie de signalisation Hedgehog (Hh), une voie souvent liées à des processus de développement embryologique ainsi qu’au niveau des tissus adultes. Suite à nos expériences, j’ai déterminé que les astrocytes produisent et secrètent le ligand Sonic Hh (Shh) et que les cellules endothéliales humaines en cultures primaires expriment le récepteur Patched (Ptch)-1, le co-récepteur Smoothened (Smo) et le facteur de transcription Gli-1. De plus, l’activation de la voie Hh augmente l’étanchéité des cellules endothéliales de la BHE in vitro. Le blocage de l’activation de la voie Hh en utilisant l’antagoniste cyclopamine ainsi qu’en utilisant des souris Shh déficientes (-/-) diminue l’expression des protéines de jonctions serrées, claudin-5, occcludin, et ZO-1. La voie de signalisation s’est aussi montrée comme étant immunomodulatoire, puisque l’activation de la voie dans les cellules endothéliales de la BHE diminue l’expression de surface des molécules d’adhésion ICAM-1 et VCAM-1, ainsi que la sécrétion des chimiokines pro-inflammatoires IL-8/CXCL8 et MCP-1/CCL2, créant une diminution de la migration des lymphocytes CD4+ à travers une monocouche de cellules endothéliales de la BHE. Des traitements avec des cytokines pro-inflammatoires TNF-α and IFN-γ in vitro, augmente la production de Shh par les astrocytes ainsi que l’expression de surface de Ptch-1 et de Smo. Dans des lésions actives de la sclérose en plaques (SEP), où la BHE est plus perméable, les astrocytes hypertrophiques augmentent leur expression de Shh. Par contre, les cellules endothéliales de la BHE n’augmentent pas leur expression de Ptch-1 ou Smo, suggérant une dysfonction dans la voie de signalisation Hh. Ces résultats montrent que la voie de signalisation Hh promeut les propriétés de la BHE, et qu’un environnement d’inflammation pourrait potentiellement dérégler la BHE en affectant la voie de signalisation Hh des cellules endothéliales.