966 resultados para identificação de parâmetros


Relevância:

20.00% 20.00%

Publicador:

Resumo:

This work presents a diagnosis faults system (rotor, stator, and contamination) of three-phase induction motor through equivalent circuit parameters and using techniques patterns recognition. The technology fault diagnostics in engines are evolving and becoming increasingly important in the field of electrical machinery. The neural networks have the ability to classify non-linear relationships between signals through the patterns identification of signals related. It is carried out induction motor´s simulations through the program Matlab R & Simulink R , and produced some faults from modifications in the equivalent circuit parameters. A system is implemented with multiples classifying neural network two neural networks to receive these results and, after well-trained, to accomplish the identification of fault´s pattern

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Microstrip antennas are subject matter in several research fields due to its numerous advantages. The discovery, at 1999, of a new class of materials called metamaterials - usually composed of metallic elements immersed in a dielectric medium, have attracted the attention of the scientific community, due to its electromagnetic properties, especially the ability to use in planar structures, such as microstrip, without interfering with their traditional geometry. The aim of this paper is to analyze the effects of one and bidimensional metamaterial substrates in microstrip antennas, with different configurations of resonance rings, SRR, in the dielectric layer. Fractal geometry is applied to these rings, in seeking to verify a multiband behavior and to reduce the resonance frequency of the antennas. The results are then given by commercial software Ansoft HFSS, used for precise analysis of the electromagnetic behavior of antennas by Finite Element Method (FEM). To reach it, this essay will first perform a literature study on fractal geometry and its generative process. This paper also presents an analysis of microstrip antennas, with emphasis on addressing different types of substrates as part of its electric and magnetic anisotropic behavior. It s performed too an approach on metamaterials and their unique properties

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The present work has as objective to present a method of project and implementation of controllers PID, based on industrial instrumentation. An automatic system of auto-tunning of controllers PID will be presented, for systems of first and second order. The software presented in this work is applied in controlled plants by PID controllers implemented in a CLP. Software is applied to make the auto-tunning of the parameters of controller PID of plants that need this tunning. Software presents two stages, the first one is the stage of identification of the system using the least square recursive algorithm and the second is the stage of project of the parameters of controller PID using the root locus algorithm. An important fact of this work is the use of industrial instrumentation for the accomplishment of the experiments. The experiments had been carried through in controlled real plants for controllers PID implemented in the CLP. Thus has not only one resulted obtained with theoreticians experiments made with computational programs, and yes resulted obtained of real systems. The experiments had shown good results gotten with developed software

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This work presents a modelling and identification method for a wheeled mobile robot, including the actuator dynamics. Instead of the classic modelling approach, where the robot position coordinates (x,y) are utilized as state variables (resulting in a non linear model), the proposed discrete model is based on the travelled distance increment Delta_l. Thus, the resulting model is linear and time invariant and it can be identified through classical methods such as Recursive Least Mean Squares. This approach has a problem: Delta_l can not be directly measured. In this paper, this problem is solved using an estimate of Delta_l based on a second order polynomial approximation. Experimental data were colected and the proposed method was used to identify the model of a real robot

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This work uses computer vision algorithms related to features in the identification of medicine boxes for the visually impaired. The system is for people who have a disease that compromises his vision, hindering the identification of the correct medicine to be ingested. We use the camera, available in several popular devices such as computers, televisions and phones, to identify the box of the correct medicine and audio through the image, showing the poor information about the medication, such: as the dosage, indication and contraindications of the medication. We utilize a model of object detection using algorithms to identify the features in the boxes of drugs and playing the audio at the time of detection of feauteres in those boxes. Experiments carried out with 15 people show that where 93 % think that the system is useful and very helpful in identifying drugs for boxes. So, it is necessary to make use of this technology to help several people with visual impairments to take the right medicine, at the time indicated in advance by the physician

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Due to major progress of communication system in the last decades, need for more precise characterization of used components. The S-parameters modeling has been used to characterization, simulation and test of communication system. However, limitation of S-parameters to model nonlinear system has created new modeling systems that include the nonlinear characteristics. The polyharmonic distortion modeling is a characterizationg technique for nonlinear systems that has been growing up due to praticity and similarity with S-parameters. This work presents analysis the polyharmonic distortion modeling, the test bench development for simulation of planar structure and planar structure characterization with X-parameters

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The traditional perimeter-based approach for computer network security (the castle and the moat model) hinders the progress of enterprise systems and promotes, both in administrators and users, the delusion that systems are protected. To deal with the new range of threats, a new data-safety oriented paradigm, called de-perimeterisation , began to be studied in the last decade. One of the requirements for the implementation of the de-perimeterised model of security is the definition of a safe and effective mechanism for federated identity. This work seeks to fill this gap by presenting the specification, modelling and implementation of a mechanism for federated identity, based on the combination of SAML and X.509 digital certificates stored in smart-cards, following the A3 standard of ICP-Brasil (Brazilian official certificate authority and PKI)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In general, the designs of equipment takes into account the effects and processes of deterioration it will undergo and arrives at an approximate useful life. However, changes in operational processes and parameters, the action of external agents, the kind of maintenance conducted, the means of monitoring, and natural and accidental occurrences completely modify the desired performance of the equipment. The discontinuities that occur in anisotropic materials often and due to different factors evolve from being subcritical to critical acquiring the status of defect and compromising the physical integrity of the equipment. Increasingly sophisticated technological means of detection, monitoring and assessment of these discontinuities are required to respond ever more rapidly to the requirements of industry. This paper therefore presents a VPS (Virtual Pipe System) computational tool which uses the results of ultrasonic tests on equipment, plotting the discontinuities found in models created in the CAD and CAE systems, and then simulates the behavior of these defects in the structure to give an instantaneous view of the final behavior. This paper also presents an alternative method of conventional ultrasonic testing which correlates the integrity of an overlay (carbon steel and stainless steel attached by welding) and the reflection of ultrasonic waves coming from the interface between the two metals, thus making it possible to identify cracks in the casing and a shift of the overlay

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

O presente estudo teve o objetivo de determinar genótipos superiores de girassol, bem como realizar estudos de correlação entre suas características. Avaliou-se seis híbridos de girassol em condições de safrinha no município de Palotina - PR. O estudo avaliou quinze variáveis: massa seca de folhas, massa seca de caule e pecíolos, massa seca total, área foliar, altura de planta, diâmetro de colmo, massa de grãos por capítulo, diâmetro de capítulo, percentagem de grãos normais, massa de mil grãos, número de grãos por capítulo, produtividade, teor de proteína bruta, teor de óleo e rendimento de óleo. Os dados direcionam os híbridos H360 e MG2 com boa produtividade e maior teor de óleo para a produção de óleo e os híbridos M734 e Aguará 3 para a alimentação animal, com boa produtividade e menor teor de óleo. As correlações entre produtividade e os componentes de produção foram de 0,62; 0,47; 0,60; 0,49 e 0,47 para massa de grãos por capítulo, diâmetro de capítulo, percentagem de grãos normais, massa de mil grãos e número de grãos por capítulo, respectivamente, concluindo que a seleção de materiais a partir desses componentes ocasionará a seleção de materiais promissores em produtividade.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Lotes de sementes de braquiária comercializados no Brasil vem apresentando contaminações com sementes de outras espécies pertencentes ao mesmo gênero. Deste modo, uma das espécies de braquiária atuaria como planta infestante da outra no agroecossistema e a erradicação da espécie infestante seria dificultada pela agressividade característica do gênero e pela falta de seletividade dos herbicidas disponíveis no mercado. Esses fatores ressaltam a importância da comercialização e utilização de lotes de sementes isento de sementes de outras espécies e a utilização de metodologias precisas de identificação das principais espécies de braquiária no controle de qualidade das empresas produtoras de sementes. Neste trabalho, buscou-se avaliar o potencial discriminante da técnica de eletroforese, utilizando quatro sistemas enzimáticos presentes em plântulas de quatro espécies do gênero Brachiaria, quer sejam B. brizantha cv. Marandu, B. decumbens cv. Basilisk, B. humidicola cv. comercial e B. plantaginea. Foram realizadas análises de eletroforese de isoenzimas testando-se 50 indivíduos de cada espécie por tratamento, utilizando-se coleóptilos de plântulas obtidas a partir de sementes germinadas a 30°C, no escuro. Para a eletroforese foi utilizado como meio suporte géis de poliacrilamida, nas concentrações de 7,0 e 7,5%. As isoenzimas Glutamato desidrogenase e Glucose-6-fosfato desidrogenase, embora eficientes na diferenciação entre B. plantaginea e B. humidicola e entre as sementes dessas espécies e as de B. brizantha ou B. decumbens, não se mostraram capazes de diferenciar as sementes destas duas últimas espécies. Entretanto, as izoenzimas α- e β-esterase possibilitaram uma nítida diferenciação das quatro espécies de Brachiaria estudadas.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

O presente trabalho teve como objetivo avaliar o efeito dos estádios de colheita e do repouso pós-colheita dos frutos na qualidade de sementes de mamoneira (Ricinus communis L.) cultivar AL Guarany 2002. Foram avaliadas 9 épocas de colheita dos racemos, dos 30 até 142 dias após a antese (DAA), em intervalos de 14 dias e quatro condições de repouso: sem e com repouso de sete dias de sementes extraídas (nuas), de frutos e de frutos presos ao racemo. Foram avaliados a cor de frutos e de sementes; o teor de água, a massa seca, as porcentagens de germinação e de vigor das sementes (primeira contagem de germinação, índice de velocidade de emergência e condutividade elétrica). Sementes com máxima qualidade fisiológica e massa seca foram obtidas de frutos colhidos aos 86 DAA. A colheita pode ser realizada até os 128 DAA sem redução da germinação, mas com prejuízos devido à queda dos frutos, dispersão das sementes aos 100 dias e reduções do vigor. O repouso permitiu a antecipação da colheita para 72 DAA sem prejuízos à germinação e massa seca, mas com reduções de vigor. A cor dos frutos, das sementes e o teor de água das sementes são parâmetros eficientes para a identificação do ponto de colheita, principalmente se usados conjuntamente.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Extended storage of refrigerated milk can lead to reduced quality of raw and processed milk, which is a consequence of the growth and metabolic activities of psychrotrophic bacteria, able to grow under 7oC or lower temperatures. Although most of these microorganisms are destroyed by heat treatment, some have the potential to produce termoresistant proteolytic and lipolytic enzymes that can survive even UHT processing and reduce the processed products quality. Recently, the IN 51 determineds that milk should be refrigerated and stored at the farm what increased the importance of this group of microorganisms. In this work, psychrotrophic bacteria were isolated from 20 communitarian bulk tanks and 23 individual bulk tanks from dairy farms located at Zona da Mata region of Minas Gerais State and from southeastern Rio de Janeiro. Selected milk dilutions were plated on standard agar and after incubation for 10 days at 7oC, five colonies were isolated, firstly using nutrient agar and after using McConkey agar for 24 hours at 21oC. The isolates were identified by morphology, Gram stain method, catalase production, fermentative/oxidative metabolism and by API 20E, API 20NE, API Staph, API Coryne or API 50 CH (BioMerieux). In order to ensure reproductibility, API was repeated for 50% of the isolates. Species identification was considered when APILAB indexes reached 75% or higher. 309 strains were isolated, 250 Gram negative and 59 Gram positive. 250 Gram negative isolates were identified as: Acinetobacter spp. (39), Aeromonas spp. (07), A. Hydrophila (16), A. sobria (1), A. caviae (1), Alcaligenes feacalis (1), Burkholderia cepacia (12), Chryseomonas luteola (3), Enterobacter sp. (1), Ewingella americana(6), Hafnia alvei (7), Klebsiella sp. (1), Klebsiella oxytoca (10), Yersinia spp. (2), Methylobacterium mesophilicum (1), Moraxella spp. (4), Pantoea spp. (16), Pasteurella sp. (1), Pseudomonas spp. (10), P. fluorescens (94), P. putida (3), Serratia spp. (3), Sphigomonas paucomobilis (1). Five isolates kept unidentified. Pseudomonas was the predominant bacteria found (43%) and P. fluorescens the predominant species (37.6%), in accordance with previous reports. Qualitative analysis of proteolytic and lipolytic activity was based on halo formation using caseinate agar and tributirina agar during 72 hours at 21oC and during 10 days at 4°C, 10oC and 7°C. Among 250 Gram negative bacteria found, 104 were identified as Pseudomonas spp. and 60,57% of this group showed proteolytic and lipolytic acitivities over all four studied temperatures. 20% of Acinetobacter, Aeromonas, Alcaligenes, Burkholderia, Chryseomonas, Methylobacterium, Moraxella presented only lipolytic activity. Some isolates presented enzymatic activity in one or more studied temperatures. Among Gram positive bacteria, 30.51% were proteolytic and lipolytic at 10oC, 8.47% were proteolytic at 7oC, 10oC, and 21oC, 8.47% were proteolytic at all studied temperatures (4oC, 7oC, 10oC and 21oC) and 3.38% were proteolytic only at 21oC. At 4oC, only one isolate showed proteolytic activity and six isolates were lipolytic. In relation to Gram negative microorganisms, 4% were proteolytic and lipolytic at 7oC, 10oC and 21oC, 10% were proteolytic at 10oC and 4.4% were lipolytic at 4oC, 7oC, 10oC and 21oC, while 6.4% of all isolates were proteolytic and lipolytic at 10oC and 21oC as well as lipolytic at 4oC and 7oC. These findings are in accordance with previous researches that pointed out Pseudomonas as the predominant psycrotrophic flora in stored refrigerated raw milk