Temporal and spatial evolution of laser ablated plasma from YBa2Cu3O7

YBa2Cu307 target was laser ablated, and the time-of-flight (TOF) distributions of Y, Y+., and YO in the resultant plasma were investigated as functions of distance from the target and laser energy density using emission spectroscopy. Up to a short distance from the target (-1.5 cm), TOF distributions show twin peaks for Y and YO, while only single-peak distribution is observed for Y+. At greater distances (>1.5 cm) all of them exhibit single-peak distribution. The twin peaks are assigned to species corresponding to those generated directly/m the vicinity of target surface and to those generated from collisional/recombination process.

Polyphase Implementation of Non-recursive Comb Decimators for Sigma-Delta A/D Converters

In a sigma-delta analog to digital (A/D) As most of the sigma-delta ADC applications require converter, the most computationally intensive block is decimation filters with linear phase characteristics, the decimation filter and its hardware implementation symmetric Finite Impulse Response (FIR) filters are may require millions of transistors. Since these widely used for implementation. But the number of FIR converters are now targeted for a portable application, filter coefficients will be quite large for implementing a a hardware efficient design is an implicit requirement. narrow band decimation filter. Implementing decimation In this effect, this paper presents a computationally filter in several stages reduces the total number of filter efficient polyphase implementation of non-recursive coefficients, and hence reduces the hardware complexity cascaded integrator comb (CIC) decimators for and power consumption [2]. Sigma-Delta Converters (SDCs). The SDCs are The first stage of decimation filter can be operating at high oversampling frequencies and hence implemented very efficiently using a cascade of integrators require large sampling rate conversions. The filtering and comb filters which do not require multiplication or and rate reduction are performed in several stages to coefficient storage. The remaining filtering is performed reduce hardware complexity and power dissipation. either in single stage or in two stages with more complex The CIC filters are widely adopted as the first stage of FIR or infinite impulse response (IIR) filters according to decimation due to its multiplier free structure. In this the requirements. The amount of passband aliasing or research, the performance of polyphase structure is imaging error can be brought within prescribed bounds by compared with the CICs using recursive and increasing the number of stages in the CIC filter. The non-recursive algorithms in terms of power, speed and width of the passband and the frequency characteristics area. This polyphase implementation offers high speed outside the passband are severely limited. So, CIC filters operation and low power consumption. The polyphase are used to make the transition between high and low implementation of 4th order CIC filter with a sampling rates. Conventional filters operating at low decimation factor of '64' and input word length of sampling rate are used to attain the required transition '4-bits' offers about 70% and 37% of power saving bandwidth and stopband attenuation. compared to the corresponding recursive and Several papers are available in literature that deals non-recursive implementations respectively. The same with different implementations of decimation filter polyphase CIC filter can operate about 7 times faster architecture for sigma-delta ADCs. Hogenauer has than the recursive and about 3.7 times faster than the described the design procedures for decimation and non-recursive CIC filters.

Wideband Low-Distortion Sigma-Delta ADC for WLAN

This work presents a wideband low-distortion sigmadelta analog-to-digital converter (ADC) for Wireless Local Area Network (WLAN) standard. The proposed converter makes use of low-distortion swing suppression SDM architecture which is highly suitable for low oversampling ratios to attain high linearity over a wide bandwidth. The modulator employs a 2-2 cascaded sigma-delta modulator with feedforward path with a single-bit quantizer in the first stage and 4-bit in the second stage. The modulator is designed in TSMC 0.18um CMOS technology and operates at 1.8V supply voltage. Simulation results show that, a peak SNDR of 57dB and a spurious free dynamic range (SFDR) of 66dB is obtained for a 10MHz signal bandwidth, and an oversampling ratio of 8.

The phytocannabinoid Delta(9)-tetrahydrocannabivarin modulates inhibitory neurotransmission in the cerebellum

Background and purposeThe phytocannabinoid Delta(9)-tetrahydrocannabivarin (Delta(9)-THCV) has been reported to exhibit a diverse pharmacology; here, we investigate functional effects of Delta(9)-THCV, extracted from Cannabis sativa, using electrophysiological techniques to define its mechanism of action in the CNS.Experimental approachEffects of Delta(9)-THCV and synthetic cannabinoid agents on inhibitory neurotransmission at interneurone-Purkinje cell (IN-PC) synapses were correlated with effects on spontaneous PC output using single-cell and multi-electrode array (MEA) electrophysiological recordings respectively, in mouse cerebellar brain slices in vitro.Key resultsThe cannabinoid receptor agonist WIN 55,212-2 (WIN55) decreased miniature inhibitory postsynaptic current (mIPSC) frequency at IN-PC synapses. WIN55-induced inhibition was reversed by Delta(9)-THCV, and also by the CB(1) receptor antagonist AM251; Delta(9)-THCV or AM251 acted to increase mIPSC frequency beyond basal values. When applied alone, Delta(9)-THCV, AM251 or rimonabant increased mIPSC frequency. Pre-incubation with Delta(9)-THCV blocked WIN55-induced inhibition. In MEA recordings, WIN55 increased PC spike firing rate; Delta(9)-THCV and AM251 acted in the opposite direction to decrease spike firing. The effects of Delta(9)-THCV and WIN55 were attenuated by the GABA(A) receptor antagonist bicuculline methiodide.Conclusions and implicationsWe show for the first time that Delta(9)-THCV acts as a functional CB(1) receptor antagonist in the CNS to modulate inhibitory neurotransmission at IN-PC synapses and spontaneous PC output. Delta(9)-THCV- and AM251-induced increases in mIPSC frequency beyond basal levels were consistent with basal CB(1) receptor activity. WIN55-induced increases in PC spike firing rate were consistent with synaptic disinhibition; whilst Delta(9)-THCV- and AM251-induced decreases in spike firing suggest a mechanism of PC inhibition.British Journal of Pharmacology advance online publication, 3 March 2008; doi:10.1038/bjp.2008.57.

Evolution of the modern Nile delta promontories: development of accretional features during shoreline retreat

The active accretional features that have developed along the modern Nile Delta promontories during shoreline retreat are analysed using topographic maps, remote imagery, ground and hydrographic surveys, together providing 15 time-slice maps (1922-2000) at Rosetta and 14 time-slice maps (1909-2000) at Damietta. Small double sandy spits developed and persisted at Rosetta between 1986 and 1991. At Damietta, a much larger single spit, 9 km long, formed approximately east of the mouth of the Damietta Nile branch between 1955 and 1972, although its source has now been depleted. Both the Rosetta and Damietta inlets are associated with submerged mouth bars that accumulated prior to the damming of the Nile, but that continue to contribute to local sedimentation problems, particularly at Rosetta. The development of the active accretional features along the Nile promontories reflects a combination of factors including sediment availability, transport pathways from source areas, a decrease in the magnitude of Nile flood discharges, as well as the impact of protective structures at the river mouths.

Supramolecular parallel beta-sheet and amyloid-like fibril forming peptides using delta-aminovaleric acid residue

Four terminally blocked tripeptides containing delta-aminovaleric acid residue self-assemble to form supramolecular beta-sheet structures as are revealed from their FT-IR data. Single crystal X-ray diffraction studies of two representative peptides also show that they form parallel beta-sheet structures. Self-aggregation of these beta-sheet forming peptides leads to the formation of fibrillar structures, as is evident from scanning electron microscopic (SEM) and transmission electron microscopic (TEM) images. These peptide fibrils bind to a physiological dye, Congo red and exhibit a typical green-gold birefringence under polarized light, showing close resemblance to neurodegenerative disease causing amyloid fibrils. (c) 2005 Elsevier Ltd. All rights reserved.

Supramolecular helix and beta-sheet through self-assembly of two isomeric tetrapeptides in crystals and formation of filaments and ribbons in the solid state

Single crystal X-ray diffraction studies show that the beta-turn structure of tetrapeptide I, Boc-Gly-Phe-Aib-Leu-OMe (Aib: alpha-amino isobutyric acid) self-assembles to a supramolecular helix through intermolecular hydrogen bonding along the crystallographic a axis. By contrast the beta-turn structure of an isomeric tetrapeptide II, Boc-Gly-Leu-Aib-Phe-OMe self-assembles to a supramolecular beta-sheet-like structure via a two-dimensional (a, b axis) intermolecular hydrogen bonding network and pi-pi interactions. FT-IR studies of the peptides revealed that both of them form intermolecularly hydrogen bonded supramolecular structures in the solid state. Field emission scanning electron micrographs (FE-SEM) of the dried fibrous materials of the peptides show different morphologies, non-twisted filaments in case of peptide I and non-twisted filaments and ribbon-like structures in case of peptide II.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Crystal design approaches for the synthesis of paracetamol co-crystals

Crystal engineering principles were used to design three new co-crystals of paracetamol. A variety of potential cocrystal formers were initially identified from a search of the Cambridge Structural Database for molecules with complementary hydrogen-bond forming functionalities. Subsequent screening by powder X-ray diffraction of the products of the reaction of this library of molecules with paracetamol led to the discovery of new binary crystalline phases of paracetamol with trans-1,4- diaminocyclohexane (1); trans-1,4-di(4-pyridyl)ethylene (2); and 1,2-bis(4-pyridyl)ethane (3). The co-crystals were characterized by IR spectroscopy, differential scanning calorimetry, and 1H NMR spectroscopy. Single crystal X-ray structure analysis reveals that in all three co-crystals the co-crystal formers (CCF) are hydrogen bonded to the paracetamol molecules through O−H···N interactions. In co-crystals (1) and (2) the CCFs are interleaved between the chains of paracetamol molecules, while in co-crystal (3) there is an additional N−H···N hydrogen bond between the two components. A hierarchy of hydrogen bond formation is observed in which the best donor in the system, the phenolic O−H group of paracetamol, is preferentially hydrogen bonded to the best acceptor, the basic nitrogen atom of the co-crystal former. The geometric aspects of the hydrogen bonds in co-crystals 1−3 are discussed in terms of their electrostatic and charge-transfer components.

Using laboratory and field measurements to constrain a single habit shortwave optical parameterization for cirrus

A single habit parameterization for the shortwave optical properties of cirrus is presented. The parameterization utilizes a hollow particle geometry, with stepped internal cavities as identified in laboratory and field studies. This particular habit was chosen as both experimental and theoretical results show that the particle exhibits lower asymmetry parameters when compared to solid crystals of the same aspect ratio. The aspect ratio of the particle was varied as a function of maximum dimension, D, in order to adhere to the same physical relationships assumed in the microphysical scheme in a configuration of the Met Office atmosphere-only global model, concerning particle mass, size and effective density. Single scattering properties were then computed using T-Matrix, Ray Tracing with Diffraction on Facets (RTDF) and Ray Tracing (RT) for small, medium, and large size parameters respectively. The scattering properties were integrated over 28 particle size distributions as used in the microphysical scheme. The fits were then parameterized as simple functions of Ice Water Content (IWC) for 6 shortwave bands. The parameterization was implemented into the GA6 configuration of the Met Office Unified Model along with the current operational long-wave parameterization. The GA6 configuration is used to simulate the annual twenty-year short-wave (SW) fluxes at top-of-atmosphere (TOA) and also the temperature and humidity structure of the atmosphere. The parameterization presented here is compared against the current operational model and a more recent habit mixture model.

Hydrodynamical simulations of Galactic fountains - I. Evolution of single fountains

The ejection of the gas out of the disc in late-type galaxies is related to star formation and is due mainly to Type II supernovae. In this paper, we studied in detail the development of the Galactic fountains in order to understand their dynamical evolution and their influence on the redistribution of the freshly delivered metals over the disc. To this aim, we performed a number of 3D hydrodynamical radiative cooling simulations of the gas in the Milky Way where the whole Galaxy structure, the Galactic differential rotation and the supernova explosions generated by a single OB association are considered. A typical fountain powered by 100 Type II supernovae may eject material up to similar to 2 kpc which than collapses back mostly in the form of dense, cold clouds and filaments. The majority of the gas lifted up by the fountains falls back on the disc remaining within a radial distance Delta R = 0.5 kpc from the place where the fountain originated. This localized circulation of disc gas does not influence the radial chemical gradients on large scale, as required by the chemical models of the Milky Way which reproduce the metallicity distribution without invoking large fluxes of metals. Simulations of multiple fountains fuelled by Type II supernovae of different OB associations will be presented in a companion paper.

Single-step chemical synthesis of ferrite hollow nanospheres

We report a single-step chemical synthesis of iron oxide hollow nanospheres with 9.3 nm in diameter. The sample presents a narrow particle diameter distribution and chemical homogeneity. The hollow nature of the particles is confirmed by HRTEM and HAADF STEM analysis. Electron and x-ray diffraction show that the outer material component is constituted by 2 nm ferrite crystals. Mossbauer data provide further evidence for the formation of iron oxide with high structural disorder, magnetically ordered at 4.2 K and superparamagnetism at room temperature. An unusual magnetic behavior under an applied field is reported, which can be explained by the large fraction of atoms existing at both inner and outer surfaces.

UV optical absorption spectra analysis of beryl crystals from Brazil

The spectral decomposition analysis was applied to the optical absorption spectra of green and colorless beryl crystals from the Brazilian Eastern Pegmatitic province in the natural state, Submitted to heat treatment and irradiated with UV light The attributions of the lines were made taking into account highly accurate quantum mechanical calculations The deconvolution of the green beryl spectra revealed four lines, two of them around 12,000 cm(-1) (1 5eV) and two of them around 34,000 cm(-1) (4.2 eV) attributed to Fe(2+) and Fe(3+), respectively The deconvolution of the colorless beryl spectra without any treatment, after heating and for the same heat treatment followed by UV light irradiation revealed five lines The analysis of ratio relations showed that the lines at 36,400 cm(-1) (4.5 eV) and 41,400 cm(-1) (5 1 eV) belongs to a single defect attributed to a silicon dangling bond defect (=Si). Discussions and comparison with reported defects in quartz have supported the allocation of the lines at 61,000 cm(-1) (7.6 eV) and 43,800 cm(-1) (5 4 eV) to diamagnetic oxygen vacancy defect ( Si-Si ) and unrelaxed ( Si Si ) defect, respectively Finally, the line at 39.100 cm(-1) (4.8 eV), quite polarized along the c-axis, was attributed to a (Fe(2+) OH(-)) defect in the structural channels (C) 2009 Elsevier B V All rights reserved

Long-term follow-up of topical 5-aminolaevulinic acid photodynamic therapy diode laser single session for non-melanoma skin cancer

Photodynamic therapy (PDT) is based on the association of a light source and tight sensitive agents in order to cause the selective death of tumor cells. To evaluate topical 5-aminolaevulinic acid (5-ALA) and diode laser photodynamic single session therapy single session for non-melanoma skin cancer (NMSC), a long-term follow-up was performed. Nineteen Bowen`s disease (BD) and 15 basal cell. carcinoma (BCC) lesions were submitted to 6-h topical and occlusive 20% 5-ALA plus DMSO and EDTA, and later were exposed to 630 nm diode laser, 100 or 300 J cm(-2) dose. At 3 months tumor-free rate was 91.2% (31/34) whereas at 60 months, 57.7% (15/26), slightly higher in BCC (63.6%; 7/11). The relation between the reduction of the clinical response and the increase of tumor dimension observed at 18 months was lost at 60 months. The sBCC recurrence was earlier compared to the nBCC one. ALA-PDT offered important advantages: it is minimally invasive, an option for patients under risk of surgical complications; clinical feasibility; treatment of multiple lesions in only one session or lesions in poor heating sites and superior esthetical results. However, the recurrence rate increase after ALA-PDT diode laser single session can be observed at tong-term follow-up, and the repetitive sessions, an additional. advantage of the method, is strongly recommended. The clinical response and recurrence time seem to be related to the laser light dose and NMSC types/sub-types, thickness and dimension, which must be considered for the choice of the ALA-PDT. (C) 2009 Elsevier B.V. All rights reserved.

Time-resolved study electronic and thermal contributions to the nonlinear refractive index of Nd3+: SBN laser crystals

The propagation of an optical beam through dielectric media induces changes in the refractive index, An, which causes self-focusing or self-defocusing. In the particular case of ion-doped solids, there are thermal and non-thermal lens effects, where the latter is due to the polarizability difference, Delta alpha, between the excited and ground states, the so-called population lens (PL) effect. PL is a pure electronic contribution to the nonlinearity, while the thermal lens (TL) effect is caused by the conversion of part of the absorbed energy into heat. In time-resolved measurements such as Z-scan and TL transient experiments, it is not easy to separate these two contributions to nonlinear refractive index because they usually have similar response times. In this work, we performed time-resolved measurements using both Z-scan and mode mismatched TL in order to discriminate thermal and electronic contributions to the laser-induced refractive index change of the Nd3+-doped Strontium Barium Niobate (SrxBa1-xNb2O6) laser crystal. Combining numerical simulations with experimental results we could successfully distinguish between the two contributions to An. (C) 2007 Elsevier B.V. All rights reserved.