970 resultados para Tetraammine- and pentaammine ruthenium complexes
Resumo:
The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.
Resumo:
Ruthenium, rhodium, and iridium piano stool complexes of the pentafluorophenyl-substituted diphosphine (C6F5)2PCH2P(C6F5)2 (2) have been prepared and structurally characterized by single-crystal X-ray diffraction. The Cp-P tethered complex [{(C5Me4CH2C6F4(C6F5)CH2P(C6F5)2}RhCl2] (9), in which only one phosphorus is coordinated to the rhodium, was prepared by thermolysis of a slurry of [Cp*RhCl(-Cl)]2 and 2 and was structurally characterized by single-crystal X-ray diffraction. The tethering occurs by intramolecular dehydrofluorinative coupling of the pentamethylcyclopentadienyl ligand and P,P-coordinated 2. The geometric changes that occur on tethering force dissociation of one of the phosphorus atoms. The effects of introducing phosphine ligands to the coordination sphere of piano stool hydrogen transfer catalysts have been studied. The complexes of fluorinated phosphine complexes are found to transfer hydrogen at rates that compare favorably with leading catalysts, particularly when the phosphine and cyclopentadienyl functionalities are tethered. The highly chelating Cp-PP complex [(C5Me4CH2-2-C5F3N-4-PPhCH2CH2PPh2)RhCl]BF4 (1) was found to outperform all other complexes tested. The mechanism of hydrogen transfer catalyzed by piano stool phosphine complexes is discussed with reference to the trends in activity observed.
Resumo:
A series of benzothiazole-substituted trisbipyridine ruthenium(II) analogues {[Ru(bpy)(2)(4,5'-bbtb)](2+), [Ru(bpy)(2)(5,5'-bbtb)](2+) and [Ru(bpy)(2)(5-mbtb)](2+) [bpy is 2,2'-bipyridine, bbtb is bis(benzothiazol-2-yl)-2,2'-bipyridine, 5-mbtb is 5-(benzothiazol-2-yl),5'-methyl-2,2'-bipyridine]} have been prepared and compared with the complex [Ru(bpy)(2)(4,4'-bbtb)](2+) reported previously. From the UV-vis spectral studies, substitution at the 5-position of the bpy causes the ligand-centred transitions to occur at considerably lower energy than for those with the functionality at the 4-position, while at the same time causing the emission to be effectively quenched. However, substitution at the 4-position causes the metal-to-ligand charge transfer to occur at lower energies. Fluorescent intercalator displacement studies indicate that the doubly substituted complexes displace ethidium bromide from a range of oligonucleotides, with the greater preference shown for bulge and hairpin sequences by the Lambda enantiomer. Since the complexes only show small variation in the UV-vis spectra on the introduction of calf thymus DNA and a small increase in fluorescence they do not appear to be intercalators, but appear to associate within one of the grooves. All of the reported bisbenzothiazole complexes show reasonable cytotoxicity against a range of human cancer cell lines.
Resumo:
The new anionic functionalized aryldiamine ligands [2,6-(Me(2)NCH(2))(2)-4-R-C6H2](-) (R = Me(3)SiC=C, C6H5, Me(3)Si), formally derived from [2,6-(Me(2)NCH(2))(2)C6H3](-), have been prepared as their lithium compounds. The compound [Li{2,6-(Me(2)NCH(2))(2)-4-Ph-C6H2}](2) crystallizes in the monoclinic space group C2/c (no. 15) with a = 13.1225(5), b = 13.5844(7), c = 15.9859(12) Angstrom, beta = 105.329(5)degrees, V = 3264.0(3)Angstrom(3), Z = 4. The structure refinement converged to R(1) = 0.0374 for 2037 observed reflections [F-o>4 sigma(F-o)] and wR(2) = 0.0922 for 2560 unique data. The organolithium compounds have been used in transmetalation reactions to give the corresponding functionalized organoruthenium(II) complexes [Ru-II{2,6-(Me(2)NCH(2))(2)-4-R-C6H2}(terpy)]Cl-+(-) (terpy = 2,2';6',2 ''-terpyridine). The Ru-II species with R = HC = C has also been synthesized.
Resumo:
Resonance Raman (RR) spectroscopy has been used to probe the interaction between dipyridophenazine (dppz) complexes of ruthenium(II), [Ru(L)(2)(dppz)](2+) (L = 1,10-phenanthroline (1) and 2,2-bipyridyl (2)), and calf-thymus DNA. Ground electronic state RR spectra at selected probe wavelengths reveal enhancement patterns which reflect perturbation of the dppz-centered electronic transitions in the UV-vis spectra in the presence of DNA. Comparison of the RR spectra recorded of the short-lived MLCT excited states of both complexes in aqueous solution with those of the longer-lived states of the complexes in the DNA environment reveals changes to excited state modes, suggesting perturbation of electronic transitions of the dppz ligand in the excited state as a result of intercalation. The most prominent feature, at 1526 cm(-1), appears in the spectra of both 1 and 2 and is a convenient marker band for intercalation. For 1, the excited state studies have been extended to the A and A enantiomers. The marker band appears at the same frequency for both but with different relative intensities. This is interpreted as reflecting the distinctive response of the enantiomers to the chiral environment of the DNA binding sites. The results, together with some analogous data for other potentially intercalating complexes, are considered in relation to the more general application of time-resolved RR spectroscopy for investigation of intercalative interactions of photoexcited metal complexes with DNA.
Resumo:
Four ruthenium(II) complexes with the formula [Ru(eta(5)-C(5)H(5))(PP)L][CF(3)SO(3)], being (PP = two triphenylphosphine molecules), L = 1-benzylimidazole, 1; (PP = two triphenylphosphine molecules), L = 2,2'bipyridine, 2; (PP = two triphenylphosphine molecules), L = 4-Methylpyridine, 3; (PP = 1,2-bis(diphenylphosphine) ethane), L = 4-Methylpyridine, 4, were prepared, in view to evaluate their potentialities as antitumor agents. The compounds were completely characterized by NMR spectroscopy and their crystal and molecular structures were determined by X-ray diffraction. Electrochemical studies were carried out giving for all the compounds quasi-reversible processes. The images obtained by atomic force microscopy (AFM) suggest interaction with pBR322 plasmid DNA. Measurements of the viscosity of solutions of free DNA and DNA incubated with different concentrations of the compounds confirmed this interaction. The cytotoxicity of compounds 1234 was much higher than that of cisplatin against human leukemia cancer cells (HL-60 cells). IC(50) values for all the compounds are in the range of submicromolar amounts. Apoptotic death percentage was also studied resulting similar than that of cisplatin. (C) 2010 Elsevier Inc. All rights reserved.
Resumo:
The ruthenium(II)-cymene complexes [Ru(eta(6)-cymene)(bha)Cl] with substituted halogenobenzohydroxamato (bha) ligands (substituents = 4-F, 4-Cl, 4-Br, 2,4-F-2, 3,4-F-2, 2,5-F-2, 2,6-F-2) have been synthesized and characterized by elemental analysis, IR, H-1 NMR, C-13 NMR, cyclic voltammetry and controlled-potential electrolysis, and density functional theory (DFT) studies. The compositions of their frontier molecular orbitals (MOs) were established by DFT calculations, and the oxidation and reduction potentials are shown to follow the orders of the estimated vertical ionization potential and electron affinity, respectively. The electrochemical E-L Lever parameter is estimated for the first time for the various bha ligands, which can thus be ordered according to their electron-donor character. All complexes exhibit very strong protein tyrosine kinase (PTK) inhibitory activity, even much higher than that of genistein, the clinically used PTK inhibitory drug. The complex containing the 2,4-difluorobenzohydroxamato ligand is the most active one, and the dependences of the PTK activity of the complexes and of their redox potentials on the ring substituents are discussed. (C) 2012 Elsevier B.V. All rights reserved.
Resumo:
A series of mono(eta(5)-cyclopentadienyl)metal-(II) complexes with nitro-substituted thienyl acetylide ligands of general formula [M(eta(5)-C5H5)(L)(C C{C4H2S}(n)NO2)] (M = Fe, L = kappa(2)-DPPE, n = 1,2; M = Ru, L = kappa(2)-DPPE, 2 PPh3, n = 1, 2; M = Ni, L = PPh3, n = 1, 2) has been synthesized and fully characterized by NMR, FT-IR, and UV-Vis spectroscopy. The electrochemical behavior of the complexes was explored by cyclic voltammetry. Quadratic hyperpolarizabilities (beta) of the complexes have been determined by hyper-Rayleigh scattering (HRS) measurements at 1500 nm. The effect of donor abilities of different organometallic fragments on the quadratic hyperpolarizabilities was studied and correlated with spectroscopic and electrochemical data. Density functional theory (DFT) and time-dependent DFT (TDDFT) calculations were employed to get a better understanding of the second-order nonlinear optical properties in these complexes. In this series, the complexity of the push pull systems is revealed; even so, several trends in the second-order hyperpolarizability can still be recognized. In particular, the overall data seem to indicate that the existence of other electronic transitions in addition to the main MLCT clearly controls the effectiveness of the organometallic donor ability on the second-order NLO properties of these push pull systems.
Resumo:
Two new complexes, [MII(L)(Cl)(H2O)2]·H2O (where M=Ni or Ru and L = heterocyclic Schiff base, 3- hydroxyquinoxaline-2-carboxalidene-4-aminoantipyrine), have been synthesized and characterized by elemental analysis, FT-IR, UV–vis diffuse reflectance spectroscopy, FAB-MASS, TG–DTA, AAS, cyclic voltammetry, conductance and magnetic susceptibility measurements. The complexes have a distorted octahedral structure andwere found to be effective catalysts for the hydrogenation of benzene. The influence of several reaction parameters such as reaction time, temperature, hydrogen pressure, concentration of the catalyst and concentration of benzenewas tested. A turnover frequency of 5372 h−1 has been found in the case of ruthenium complex for the reduction of benzene at 80 ◦C with 3.64×10−6 mol catalyst, 0.34 mol benzene and at a hydrogen pressure of 50 bar. In the case of the nickel complex, a turnover frequency of 1718 h−1 has been found for the same reaction with 3.95×10−6 mol catalyst under similar experimental conditions. The nickel complex shows more selectivity for the formation of cyclohexene while the ruthenium complex is more selective for the formation of cyclohexane
Resumo:
The thesis deals with studies on the synthesis, characterisation and catalytic applications of some new transition metal complexes of the Schiff bases derived from 3-hydroxyquinoxaline 2-carboxaldehyde.. Schiff bases which are considered as ‘privileged ligands’ have the ability to stabilize different metals in different oxidation states and thus regulate the performance of metals in a large variety of catalytic transformations. The catalytic activity of the Schiff base complexes is highly dependant on the environment about the metal center and their conformational flexibility. Therefore it is to be expected that the introduction of bulky substituents near the coordination sites might lead to low symmetry complexes with enhanced catalytic properties. With this view new transition metal complexes of Schiff bases derived from 3-hydroxyquinoxaline-2-carboxaldehyde have been synthesised. These Schiff bases have more basic donor nitrogen atoms and the presence of the quinoxaline ring may be presumed to build a favourable topography and electronic environment in the immediate coordination sphere of the metal. The aldehyde was condensed with amines 1,8-diaminonaphthalene, 2,3-diaminomaleonitrile, 1,2-diaminocyclohexane, 2-aminophenol and 4-aminoantipyrine to give the respective Schiff bases. The oxovanadium(IV), copper(II) and ruthenium(II)complexes of these Schiff bases were synthesised and characterised. All the oxovanadium(IV) complexes have binuclear structure with a square pyramidal geometry. Ruthenium and copper form mononuclear complexes with the Schiff base derived from 4- aminoantipyrine while binuclear square planar complexes are formed with the other Schiff bases. The catalytic activity of the copper complexes was evaluated in the hydroxylation of phenol with hydrogen peroxide as oxidant. Catechol and hydroquinone are the major products. Catalytic properties of the oxovanadium(IV) complexes were evaluated in the oxidation of cyclohexene with hydrogen peroxide as the oxidant. Here allylic oxidation products rather than epoxides are formed as the major products. The ruthenium(II) complexes are found to be effective catalysts for the hydrogenation of benzene and toluene. The kinetics of hydrogenation was studied and a suitable mechanism has been proposed.
Resumo:
Six Ru(II) complexes of formula [Ru(L)(2)(PPh3)(2)] have been prepared where LH = 4-(aryl)thiosemicarbazones of thiophen-2-carbaldehyde. X-ray crystal structures of five of the complexes are reported. In all the complexes ruthenium is six coordinate with a distorted octahedral cis-P-2, cis-N-2, trans-S-2 donor environment, and each of the two thiosemicarbazone ligands are coordinated in a bidentate fashion forming a four membered chelate ring. The complexes undergo a one-electron oxidation at similar to 0.5 V vs. Ag/AgCl. The EPR spectrum of the electrochemically oxidized solution at 100 K shows a rhombic signal, with transitions at g(1) = 2.27, g(2) = 2.00 and g(3) = 1.80. DFT calculations on one of the complexes suggest that there is 35% ruthenium and 17% sulfur orbital contribution to the HOMO. These results suggest that the assignment of metal atom oxidation states in these compounds is not unambiguous. (C) 2009 Elsevier Ltd. All rights reserved.
Resumo:
In the search for a versatile building block that allows the preparation of heteroditopic tpy-pincer bridging ligands, the synthon 14'-[C6H3(CH2Br)(2)-3,5]-2,2':6',2 ''-terpyridine was synthesized. Facile introduction of diphenylphosphanyl groups in this synthon gave the ligand 14'-[C6H3(CH2PPh2)2-3,5]-2,2':6',2"-terpyridine) ([tpyPC(H)Pj). The asymmetric mononuclear complex [Fe(tpy){tpyPC(H)P}](PF6)(2), prepared by selective coordination of [Fe(tpy)Cl-3] to the tpy moiety of [tpyPC(H)P], was used for the synthesis of the heterodimetallic complex [Fe(tpy)(tpyPCP)Ru(tpy)](PFC,)3, which applies the "complex as ligand" approach. Coordination of the ruthenium centre at the PC(H)P-pincer moiety of [Fe(tpy){tpyPC(H)P}](PF6)(2) has been achieved by applying a transcyclometallation procedure. The ground-state electronic properties of both complexes, investigated by cyclic and square-wave voltammetries and UV/Vis spectroscopy, are discussed and compared with those of [Fe(tPY)(2)](PF6)(2) and [Ru(PCP)(tpy)]Cl, which represent the mononuclear components of the heterodinuclear species. An in situ UV/Vis spectroelectrochemical study was performed in order to localize the oxidation and reduction steps and to gain information about the Fe-II-Ru-II communication in the heterodimetallic system [Fe(tpy)(tpyPCP)Ru(tpy)](PF6)(3) mediated by the bridging ligand [tpyPCP]. Both the voltammetric and spectroelectrochemical results point to only very limited electronic interaction between the metal centres in the ground state.
Resumo:
Photochromic nitrospiropyrans substituted with 2,2'-bipyridine (bpy), [Ru(bpy)(3)](2+), and [Os(bpy)(3)](2+) groups were synthesized, and their photophysical, photochemical, and redox properties investigated. Substitution of the spiropyran with the metal complex moiety results in strongly decreased efficiency of the ring-opening process as a result of energy transfer from the excited spiropyran to the metal center. The lowest excited triplet state of the spiropyran in its open merocyanine form is lower in energy than the excited triplet MLCT level of the [Ru(bpy)(3)](2+) moiety but higher in energy than for [Os(bpy)(3)](2+), resulting in energy transfer from the excited ruthenium center to the spiropyran but inversely in the osmium case. The open merocyanine form reduces and oxidizes electrochemically more easily than the closed nitrospiropyran. Like photoexcitation, electrochemical activation also causes opening of the spiropyran ring by first reducing the closed form and subsequently reoxidizing the corresponding radical anion in two well-resolved anodic steps. Interestingly, the substitution of the spiropyran with a Ru or Os metal center does not affect the efficiency of this electrochemically induced ring-opening process, different from the photochemical path.
Resumo:
The dissymmetrical naphthalene-bridged complexes [Cp′Fe(μ-C10H8)FeCp*] (3; Cp* = η5-C5Me5, Cp′ = η5-C5H2-1,2,4-tBu3) and [Cp′Fe(μ-C10H8)RuCp*] (4) were synthesized via a one-pot procedure from FeCl2(thf)1.5, Cp′K, KC10H8, and [Cp* FeCl(tmeda)] (tmeda = N,N,N′,N′- tetramethylethylenediamine) or [Cp*RuCl]4, respectively. The symmetrically substituted iron ruthenium complex [Cp*Fe(μ-C10H8)RuCp*] (5) bearing two Cp* ligands was prepared as a reference compound. Compounds 3−5 are diamagnetic and display similar molecular structures, where the metal atoms are coordinated to opposite sides of the bridging naphthalene molecule. Cyclic voltammetry and UV/vis spectroelectrochemistry studies revealed that neutral 3−5 can be oxidized to monocations 3+−5+ and dications 32+−52+. The chemical oxidation of 3 and 4 with [Cp2Fe]PF6 afforded the paramagnetic hexafluorophosphate salts [Cp′Fe(μ-C10H8)FeCp*]PF6 ([3]PF6) and [Cp′Fe(μ-C10H8)RuCp*]PF6 ([4]PF6), which were characterized by various spectroscopic techniques, including EPR and 57Fe Mössbauer spectroscopy. The molecular structure of [4]PF6 was determined by X-ray crystallography. DFT calculations support the structural and spectroscopic data and determine the compositions of frontier molecular orbitals in the investigated complexes. The effects of substituting Cp* with Cp′ and Fe with Ru on the electronic structures and the structural and spectroscopic properties are analyzed.
Resumo:
Photosensitized oxidation of guanine is an important route to DNA damage. Ruthenium polypyridyls are very useful photosensitizers as their reactivity and DNA-binding properties are readily tunable. Here we show a strong difference in the reactivity of the two enantiomers of [Ru(TAP)2(dppz)]2+, by using time-resolved visible and IR spectroscopy. This reveals that the photosensitized one-electron oxidation of guanine in three oligonucleotide sequences proceeds with similar rates and yields for bound delta-[Ru(TAP)2(dppz)]2+, whereas those for the lambda enantiomer are very sensitive to base sequence. It is proposed that these differences are due to preferences of each enantiomer for different binding sites in the duplex.