An algorithm for isentropic flow

An efficient algorithm is presented for the solution of the equations of isentropic gas dynamics with a general convex gas law. The scheme is based on solving linearized Riemann problems approximately, and in more than one dimension incorporates operator splitting. In particular, only two function evaluations in each computational cell are required. The scheme is applied to a standard test problem in gas dynamics for a polytropic gas

An efficient flux difference splitting algorithm for unsteady duct flows of a real gas

A numerical scheme is presented for the solution of the Euler equations of compressible flow of a real gas in a single spatial coordinate. This includes flow in a duct of variable cross-section, as well as flow with slab, cylindrical or spherical symmetry, as well as the case of an ideal gas, and can be useful when testing codes for the two-dimensional equations governing compressible flow of a real gas. The resulting scheme requires an average of the flow variables across the interface between cells, and this average is chosen to be the arithmetic mean for computational efficiency, which is in contrast to the usual “square root” averages found in this type of scheme. The scheme is applied with success to five problems with either slab or cylindrical symmetry and for a number of equations of state. The results compare favourably with the results from other schemes.

An efficient shock capturing algorithm for compressible flows in a duct of variable cross-section

A numerical scheme is presented for the solution of the Euler equations of compressible flow of a gas in a single spatial co-ordinate. This includes flow in a duct of variable cross-section as well as flow with slab, cylindrical or spherical symmetry and can prove useful when testing codes for the two-dimensional equations governing compressible flow of a gas. The resulting scheme requires an average of the flow variables across the interface between cells and for computational efficiency this average is chosen to be the arithmetic mean, which is in contrast to the usual ‘square root’ averages found in this type of scheme. The scheme is applied with success to five problems with either slab or cylindrical symmetry and a comparison is made in the cylindrical case with results from a two-dimensional problem with no sources.

An algorithm for the shallow water equations with body fitted meshes

An efficient algorithm based on flux difference splitting is presented for the solution of the two-dimensional shallow water equations in a generalised coordinate system. The scheme is based on solving linearised Riemann problems approximately and in more than one dimension incorporates operator splitting. The scheme has good jump capturing properties and the advantage of using body-fitted meshes. Numerical results are shown for flow past a circular obstruction.

An isentropic flow algorithm with body fitted meshes

An efficient algorithm based on flux difference splitting is presented for the solution of the three-dimensional equations of isentropic flow in a generalised coordinate system, and with a general convex gas law. The scheme is based on solving linearised Riemann problems approximately and in more than one dimension incorporates operator splitting. The algorithm requires only one function evaluation of the gas law in each computational cell. The scheme has good shock capturing properties and the advantage of using body-fitted meshes. Numerical results are shown for Mach 3 flow of air past a circular cylinder. Furthermore, the algorithm also applies to shallow water flows by employing the familiar gas dynamics analogy.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Experimental determination of layer cloud edge charging from cosmic ray ionisation

The cloud-air transition zone at stratiform cloud edges is an electrically active region where droplet charging has been predicted. Cloud edge droplet charging is expected from vertical flow of cosmic ray generated atmospheric ions in the global electric circuit. Experimental confirmation of stratiform cloud edge electrification is presented here, through charge and droplet measurements made within an extensive layer of supercooled stratiform cloud, using a specially designed electrostatic sensor. Negative space charge up to 35 pC m−3 was found in a thin (<100 m) layer at the lower cloud boundary associated with the clear air-cloud conductivity gradient, agreeing closely with space charge predicted from the measured droplet concentration using ion-aerosol theory. Such charge levels carried by droplets are sufficient to influence collision processes between cloud droplets.

Structure of single-wall peptide nanotubes: in situ flow aligning X-ray diffraction

The structure of single wall peptide nanotubes is presented for the model surfactant-like peptide A6K. Capillary flow alignment of a sample in the nematic phase at high concentration in water leads to oriented X-ray diffraction patterns. Analysis of these, accompanied by molecular dynamics simulations, suggests the favourable self-assembly of antiparallel peptide dimers into beta-sheet ribbons that wrap helically to form the nanotube wall.

Small-angle x-ray scattering study of flow alignment of a thermotropic liquid crystal in the nematic and smectic phases

WThe capillary flow alignment of the thermotropic liquid crystal 4-n-octyl-4′-cyanobiphenyl in the nematic and smectic phases is investigated using time-resolved synchrotron small-angle x-ray scattering. Samples were cooled from the isotropic phase to erase prior orientation. Upon cooling through the nematic phase under Poiseuille flow in a circular capillary, a transition from the alignment of mesogens along the flow direction to the alignment of layers along the flow direction (mesogens perpendicular to flow) appears to occur continuously at the cooling rate applied. The transition is centered on a temperature at which the Leslie viscosity coefficient α3 changes sign. The configuration with layers aligned along the flow direction is also observed in the smectic phase. The transition in the nematic phase on cooling has previously been ascribed to an aligning-nonaligning or tumbling transition. At high flow rates there is evidence for tumbling around an average alignment of layers along the flow direction. At lower flow rates this orientation is more clearly defined. The layer alignment is ascribed to surface-induced ordering propagating into the bulk of the capillary, an observation supported by the parallel alignment of layers observed for a static sample at low temperatures in the nematic phase.

Synthesis, x-ray structure and anion binding properties of a cryptand-like hybrid calixpyrrole

The novel cryptand in/out-3, containing two tripyrrolemethane units briged by three 1,3- diisopropylidenbenzene arms was readily synthesized by a convergent three-step synthesis. It binds fluoride by inclusion with excellent selectivity with respect to a number of other tested anions. The structure of the free receptor and that of its fluoride complex were investigated in solution by NMR spectroscopy. The solid state X-ray structure of the free cryptand 3 was also determined.

Solving surface structures from normal incidence X-ray standing wave data

A program is provided to determine structural parameters of atoms in or adsorbed on surfaces by refinement of atomistic models towards experimentally determined data generated by the normal incidence X-ray standing wave (NIXSW) technique. The method employs a combination of Differential Evolution Genetic Algorithms and Steepest Descent Line Minimisations to provide a fast, reliable and user friendly tool for experimentalists to interpret complex multidimensional NIXSW data sets.

The TAMORA algorithm: satellite rainfall estimates over West Africa using multi-spectral SEVIRI data

A multi-spectral rainfall estimation algorithm has been developed for the Sahel region of West Africa with the purpose of producing accumulated rainfall estimates for drought monitoring and food security. Radar data were used to calibrate multi-channel SEVIRI data from MSG, and a probability of rainfall at several different rain-rates was established for each combination of SEVIRI radiances. Radar calibrations from both Europe (the SatPrecip algorithm) and Niger (TAMORA algorithm) were used. 10 day estimates were accumulated from SatPrecip and TAMORA and compared with kriged gauge data and TAMSAT satellite rainfall estimates over West Africa. SatPrecip was found to produce large overestimates for the region, probably because of its non-local calibration. TAMORA was negatively biased for areas of West Africa with relatively high rainfall, but its skill was comparable to TAMSAT for the low-rainfall region climatologically similar to its calibration area around Niamey. These results confirm the high importance of local calibration for satellite-derived rainfall estimates. As TAMORA shows no improvement in skill over TAMSAT for dekadal estimates, the extra cloud-microphysical information provided by multi-spectral data may not be useful in determining rainfall accumulations at a ten day timescale. Work is ongoing to determine whether it shows improved accuracy at shorter timescales.

Syntheses, x-ray structures, photochemistry, redox properties, and DFT calculations of interconvertible fac- and mer-[Mn(SPS)(CO)3] isomers containing a flexible SPS-based pincer ligand

The lithium salt of the anionic SPS pincer ligand composed of a central hypervalent lambda(4)-phosphinine ring bearing two ortho-positioned diphenylphosphine sulfide side arms reacts with [Mn(CO)(5)Br] to give fac-[Mn(SPS)(CO)(3)], This isomer can be converted photochemicaily to mer-[Mn(SPS)(CO)(3)], with a very high quantum yield (0.80 +/- 0.05). The thermal backreaction is slow (taking ca. 8 h at room temperature), in contrast to rapid electrodecatalyzed mer-to-fac isomerization triggered by electrochemical reduction of mer-[Mn(SPS)(CO)(3)]. Both geometric isomers of [Mn(SPS)(CO)(3)] have been characterized by X-ray crystallography. Both isomers show luminescence from a low-lying (IL)-I-3 (SPS-based) excited state. The light emission of fac-[Mn(SPS)(CO)(3)] is largely quenched by the efficient photoisomerization occurring probably from a low-lying Mn-CO dissociative excited state. Density functional theory (DFT) and time-dependent DFT calculations describe the highest occupied molecular orbital (HOMO) and lowest unoccupied molecular orbital (LUMO) of fac- and mer-[Mn(CO)(3)(SPS)] as ligand-centered orbitals, largely localized on the phosphinine ring of the SPS pincer ligand. In line with the ligand nature of its frontier orbitals, fac-[Mn(SPS)(CO)(3)] is electrochemically reversibly oxidized and reduced to the corresponding radical cation and anion, respectively. The spectroscopic (electron paramagnetic resonance, IR, and UV-vis) characterization of the radical species provides other evidence for the localization of the redox steps on the SIPS ligand. The smaller HOMO-LUMO energy difference in the case of mer-[Mn(CO)(3)(SPS)], reflected in the electronic absorption and emission spectra, corresponds with its lower oxidation potential compared to that of the fac isomer. The thermodynamic instability of mer-[Mn(CO)(3)(SPS)], confirmed by the DFT calculations, increases upon one-electron reduction and oxidation of the complex.