Supramolecular helix and beta-sheet through self-assembly of two isomeric tetrapeptides in crystals and formation of filaments and ribbons in the solid state

Single crystal X-ray diffraction studies show that the beta-turn structure of tetrapeptide I, Boc-Gly-Phe-Aib-Leu-OMe (Aib: alpha-amino isobutyric acid) self-assembles to a supramolecular helix through intermolecular hydrogen bonding along the crystallographic a axis. By contrast the beta-turn structure of an isomeric tetrapeptide II, Boc-Gly-Leu-Aib-Phe-OMe self-assembles to a supramolecular beta-sheet-like structure via a two-dimensional (a, b axis) intermolecular hydrogen bonding network and pi-pi interactions. FT-IR studies of the peptides revealed that both of them form intermolecularly hydrogen bonded supramolecular structures in the solid state. Field emission scanning electron micrographs (FE-SEM) of the dried fibrous materials of the peptides show different morphologies, non-twisted filaments in case of peptide I and non-twisted filaments and ribbon-like structures in case of peptide II.

Gas-solid reactions of single crystals: a study of reactions of NH3 and NO2 with single crystalline organic substrates by infrared microspectroscopy

Reaction of single crystals of benzoic and trans-cinnamic acids with 200 Torr pressure of ammonia gas in a sealed glass bulb at 20 degrees C generates the corresponding ammonium salts; there is no sign of any 1:2 adduct as has been reported previously for related systems. Isotopic substitution using ND3 has been used to aid identification of the products. Adipic acid likewise reacts with NH3 gas to form a product in which ammonium salts are formed at both carboxylic acid groups. Reaction of 0.5 Torr pressure of NO2 gas with single crystals of 9-methylanthracene and 9-anthracenemethanol in a flow system generates nitrated products where the nitro group appears to be attached at the 10-position, i.e. the position trans to the methyl or methoxy substituent on the central ring. Isotopic substitution using (NO2)-N-15 has been used to confirm the identity of the bands arising from the coordinated NO2 group. The products formed when single crystals of hydantoin are reacted with NO2 gas under similar conditions depend on the temperature of the reaction. At 20 degrees C, a nitrated product is formed, but at 65 degrees C this gives way to a product containing no nitro groups. The findings show the general applicability of infrared microspectroscopy to a study of gas-solid reactions of organic single crystals. (c) 2005 Elsevier B.V. All rights reserved.

Gas-solid reactions of single crystals: a study of the reaction of bromine with single crystals of trans-cinnamic acid and a range of its derivatives by infrared and Raman microspectroscopy

Single crystals of trans-cinnamic acid and of a range of derivatives of this compound containing halogen substituents on the aromatic ring have been reacted with 165 Torr pressure of bromine vapour in a sealed desiccator at 20 degrees C for 1 week. Infrared and Raman microspectroscopic examination of the crystals shows that bromination of the aliphatic double bond, but not of the aromatic ring, has occurred. It is demonstrated also that the reaction is truly gas-solid in nature. A time-dependent study of these reactions shows that they do not follow a smooth diffusion-controlled pathway. Rather the reactions appear to be inhomogeneous and to occur at defects within the crystal. The reaction products are seen to flake from the surface of the crystal. It is shown, therefore, that these are not single crystal to single crystal transitions, as have been observed previously for the photodimerisation of trans-cinnamic acid and several of its derivatives. It is shown that there are no by-products of the reaction and that finely ground samples react to form the same products as single crystals.

Pressure-jump X-ray studies of liquid crystal transitions in lipids

In this paper, we give an overview of our studies by static and time-resolved X-ray diffraction of inverse cubic phases and phase transitions in lipids. In 1, we briefly discuss the lyotropic phase behaviour of lipids, focusing attention on non-lamellar structures, and their geometric/topological relationship to fusion processes in lipid membranes. Possible pathways for transitions between different cubic phases are also outlined. In 2, we discuss the effects of hydrostatic pressure on lipid membranes and lipid phase transitions, and describe how the parameters required to predict the pressure dependence of lipid phase transition temperatures can be conveniently measured. We review some earlier results of inverse bicontinuous cubic phases from our laboratory, showing effects such as pressure-induced formation and swelling. In 3, we describe the technique of pressure-jump synchrotron X-ray diffraction. We present results that have been obtained from the lipid system 1:2 dilauroylphosphatidylcholine/lauric acid for cubic-inverse hexagonal, cubic-cubic and lamellar-cubic transitions. The rate of transition was found to increase with the amplitude of the pressure-jump and with increasing temperature. Evidence for intermediate structures occurring transiently during the transitions was also obtained. In 4, we describe an IDL-based 'AXCESS' software package being developed in our laboratory to permit batch processing and analysis of the large X-ray datasets produced by pressure-jump synchrotron experiments. In 5, we present some recent results on the fluid lamellar-Pn3m cubic phase transition of the single-chain lipid 1-monoelaidin, which we have studied both by pressure-jump and temperature-jump X-ray diffraction. Finally, in 6, we give a few indicators of future directions of this research. We anticipate that the most useful technical advance will be the development of pressure-jump apparatus on the microsecond time-scale, which will involve the use of a stack of piezoelectric pressure actuators. The pressure-jump technique is not restricted to lipid phase transitions, but can be used to study a wide range of soft matter transitions, ranging from protein unfolding and DNA unwinding and transitions, to phase transitions in thermotropic liquid crystals, surfactants and block copolymers.

Droplets of structured fluid on a flat substrate

We study the equilibrium morphology of droplets of symmetric AB diblock copolymer on a flat substrate. Using self-consistent field theory (SCFT), we provide the first predictions for the equilibrium droplet shape and its internal structure. When the sustrate affinity for the A component, $\eta_A$, is small, the droplet adopts a nearly spherical shape much like that of simple fluids. Inside the spherical droplet, however, concentric circular lamellar layers stack on top of each other; hence the thickness of the droplet is effectively quantized by a half-integer or integer number of layers. At larger $\eta_A$ and smaller contact angle, the area of the upper-most layer becomes relatively large, resulting in a nearly flat, faceted top surface, followed by a semi-spherical slope. This geometry is remarkably reminiscent of the droplet shapes observed with smetic liquid crystals.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Mechanistic insights into a gas–solid reaction in molecular crystals: the role of hydrogen bonding

Reactions in (molecular) organic crystalline solids have been shown to be important for exerting control that is unattainable over chemical transformations in solution. Such control has also been achieved for reactions within metal– organic cages. In these examples, the reactants are already in place within the crystals following the original crystal growth. The post-synthetic modification of metal–organic frameworks (MOFs and indeed reactions and catalysis within MOFs have been recently demonstrated; in these cases the reactants enter the crystals through permanent channels. Another growing area of interest within molecular solid-state chemistry is synthesis by mechanical co-grinding of solid reactants—often referred to as mechanochemistry. Finally, in a small number of reported examples, molecules also have been shown to enter nonporous crystals directly from the gas or vapor phase, but in only a few of these examples does a change in covalent bonding result, which indicates that a reaction occurs within the nonporous crystals. It is this latter type of highly uncommon reaction that is the focus of the present study.

Reversible sphere-to-lamellar wetting transition at the interface of a diblock copolymer system

We use ellipsometry to investigate a transition in the morphology of a sphere-forming diblock copolymer thin-film system. At an interface the diblock morphology may differ from the bulk when the interfacial tension favours wetting of the minority domain, thereby inducing a sphere-to-lamella transition. In a small, favourable window in energetics, one may observe this transition simply by adjusting the temperature. Ellipsometry is ideally suited to the study of the transition because the additional interface created by the wetting layer affects the polarisation of light reflected from the sample. Here we study thin films of poly(butadiene-ethylene oxide) (PB-PEO), which order to form PEO minority spheres in a PB matrix. As temperature is varied, the reversible transition from a partially wetting layer of PEO spheres to a full wetting layer at the substrate is investigated.

Kinetics of layer hopping in a diblock copolymer lamellar phase

In the ordered state, symmetric diblock copolymers self-assemble into an anisotropic lamellar morphology. The equilibrium thickness of the lamellae is the result of a delicate balance between enthalpic and entropic energies, which can be tuned by controlling the temperature. Here we devise a simple yet powerful method of detecting tiny changes in the lamellar thickness using optical microscopy. From such measurements we characterize the enthalpic interaction as well as the kinetics of molecules as they hop from one layer to the next in order to adjust the lamellar thickness in response to a temperature jump. The resolution of the measurements facilitate a direct comparison to predictions from self-consistent field theory.

Ice crystals growing from vapor in supercooled clouds between −2.5° and −22°C: testing current parameterization methods using laboratory data

The physical and empirical relationships used by microphysics schemes to control the rate at which vapor is transferred to ice crystals growing in supercooled clouds are compared with laboratory data to evaluate the realism of various model formulations. Ice crystal growth rates predicted from capacitance theory are compared with measurements from three independent laboratory studies. When the growth is diffusion- limited, the predicted growth rates are consistent with the measured values to within about 20% in 14 of the experiments analyzed, over the temperature range −2.5° to −22°C. Only two experiments showed significant disagreement with theory (growth rate overestimated by about 30%–40% at −3.7° and −10.6°C). Growth predictions using various ventilation factor parameterizations were also calculated and compared with supercooled wind tunnel data. It was found that neither of the standard parameterizations used for ventilation adequately described both needle and dendrite growth; however, by choosing habit-specific ventilation factors from previous numerical work it was possible to match the experimental data in both regimes. The relationships between crystal mass, capacitance, and fall velocity were investigated based on the laboratory data. It was found that for a given crystal size the capacitance was significantly overestimated by two of the microphysics schemes considered here, yet for a given crystal mass the growth rate was underestimated by those same schemes because of unrealistic mass/size assumptions. The fall speed for a given capacitance (controlling the residence time of a crystal in the supercooled layer relative to its effectiveness as a vapor sink, and the relative importance of ventilation effects) was found to be overpredicted by all the schemes in which fallout is permitted, implying that the modeled crystals reside for too short a time within the cloud layer and that the parameterized ventilation effect is too strong.

Evolution of network structure in polymer-stabilised liquid crystals

Experiments were performed to investigate the evolution of structure and morphology of the network in polymer-stabilised liquid crystals. In situ optical microscopy revealed that the morphology was significantly altered by extraction of the LC host, while scanning electron microscopy showed that the network morphology was also dependent on the polymerisation conditions and closely related to the depletion of monomer, as monitored by high performance liquid chromatography. Transmission electron microscopy allowed observation of internal structure, resolving microstructure on the order of 0. 1 μm.

A novel study of the polymerisation process involved in the formation of the network component of polymer-stabilised liquid crystals within electro-optic cells using high performance liquid chromatography

Polymer-stabilised liquid crystals are systems in which a small amount of monomer is dissolved within a liquid crystalline host, and then polymerised in situ to produce a network. The progress of the polymerisation, performed within electro-optic cells, was studied by establishing an analytical method novel to these systems. Samples were prepared by photopolymerisation of the monomer under well-defined reaction conditions; subsequent immersion in acetone caused the host and any unreacted monomer to dissolve. High performance liquid chromatography was used to separate and detect the various solutes in the resulting solutions, enabling the amount of unreacted monomer for a given set of conditions to be quantified. Longer irradiations cause a decrease in the proportion of unreacted monomer since more network is formed, while a more uniform LC director alignment (achieved by decreasing the sample thickness) or a higher level of order (achieved by decreasing the polymerisation temperature) promotes faster reactions.

Photo-induced phase transitions in azobenzene-doped liquid crystals

The effect of irradiation (UV-visible light) on a nematic liquid crystal doped with a photoactive azobenzene derivative was investigated. The selective irradiation results in either an E implies Z or Z implies E isomerization of the azobenzene unit. The effect of the isomerization is to cause a reversible depression of the liquid crystal to isotropic (LC implies l) phase transition temperature of the doped mixture, which can be monitored optically as an isothermal phase transition. This depression also results in a biphasic liquid crystal+isotropic region which is discussed. The authors investigate the cause and magnitude of the phase depression as a function of the amount of doped 4-butyl-4'-methoxyazobenzene (photoactive unit) in 4-cyano-4'-n-pentylbiphenyl (liquid crystal unit), and as a function of the percentage conversion of E implies Z (caused by isomerization) in the azobenzene. The photostationary state of the doped mixtures achieved by Z implies E isomerization is considered and its effect upon the transition temperature of the mixture and response time of the system is discussed. They discuss the implications of the photostationary state with regards to the reversibility of the photo-induced phase transition and hence potential applications.

The effect of the spacer length on the nature of coupling in side chain liquid crystals polymers and elastomers

Side chain liquid crystal polymers and elastomers exhibit a rich phase behaviour which arises from the antagonistic influences of the entropically disordered polymer chain configuration and the long range orientational ordering of the mesogenic units. This competition arises since the natural macroscopic phase separation is inhibited by the inherent chemical connectivity of the system. At the heart of this connectivity is the spacer link and we consider here its influence on the phase behaviour. In particular we consider a series of elastomers in which the number of alkyl units in the spacer is systematically varied from 2 to 6. The lengthening of the coupling spacer is accompanied by an alternation of the sign of coupling between the polymer chain and the mesogenic unit. These results demonstrate the dominating influence of the so-called hinge effect in determining the phase behaviour. In addition to the alternation of the sign there is some decrease in the magnitude of the coupling with increasing spacer length.