A human axillary odorant is carried by apolipoprotein D.

The characterization of the source of the odor in the human axillary region is not only of commercial interest but is also important biologically because axillary extracts can alter the length and timing of the female menstrual cycle. In males, the most abundant odor component is known to be E-3-methyl-2-hexenoic acid (E-3M2H), which is liberated from nonodorous apocrine secretions by axillary microorganisms. Recently, it was found that in the apocrine gland secretions, 3M2H is carried to the skin surface bound to two proteins, apocrine secretion odor-binding proteins 1 and 2 (ASOB1 and ASOB2) with apparent molecular masses of 45 kDa and 26 kDa, respectively. To better understand the formation of axillary odors and the structural relationship between 3M2H and its carrier protein, the amino acid sequence and glycosylation pattern of ASOB2 were determined by mass spectrometry. The ASOB2 protein was identified as apolipoprotein D (apoD), a known member of the alpha2mu-microglobulin superfamily of carrier proteins also known as lipocalins. The pattern of glycosylation for axillary apoD differs from that reported for plasma apoD, suggesting different sites of expression for the two glycoproteins. In situ hybridization of an oligonucleotide probe against apoD mRNA with axillary tissue demonstrates that the message for synthesis of this protein is specific to the apocrine glands. These results suggest a remarkable similarity between human axillary secretions and nonhuman mammalian odor sources, where lipocalins have been shown to carry the odoriferous signals used in pheromonal communication.

Characterization of a unique variant of bat rabies virus responsible for newly emerging human cases in North America.

The silver-haired bat variant of rabies virus (SHBRV) has been identified as the etiological agent of a number of recent human rabies cases in the United States that are unusual in not having been associated with any known history of conventional exposure. Comparison of the different biological and biochemical properties of isolates of this virus with those of a coyote street rabies virus (COSRV) revealed that there are unique features associated with SHBRV. In vitro studies showed that, while the susceptibility of neuroblastoma cells to infection by both viruses was similar, the infectivity of SHBRV was much higher than that of COSRV in fibroblasts (BHK-21) and epithelial cells (MA-104), particularly when these cells were kept at 34 degrees C. At this temperature, low pH-dependent fusion and cell-to-cell spread of virus is seen in BHK-21 cells infected with SHBRV but not with COSRV. It appears that SHBRV may possess an unique cellular tropism and the ability to replicate at lower temperature, allowing a more effective local replication in the dermis. This hypothesis is supported by in vivo results which showed that while SHBRV is less neurovirulent than COSRV when administered via the intramuscular or intranasal routes, both viruses are equally neuroinvasive if injected intracranially or intradermally. Consistent with the above findings, the amino acid sequences of the glycoproteins of SHBRV and COSRV were found to have substantial differences, particularly in the region that contains the putative toxic loop, which are reflected in marked differences in their antigenic composition. Nevertheless, an experimental rabies vaccine based on the Pittman Moore vaccine strain protected mice equally well from lethal doses of SHBRV and COSRV, suggesting that currently used vaccines should be effective in the postexposure prophylaxis of rabies due to SHBRV.

Human plectin: organization of the gene, sequence analysis, and chromosome localization (8q24).

Plectin, a 500-kDa intermediate filament binding protein, has been proposed to provide mechanical strength to cells and tissues by acting as a cross-linking element of the cytoskeleton. To set the basis for future studies on gene regulation, tissue-specific expression, and pathological conditions involving this protein, we have cloned the human plectin gene, determined its coding sequence, and established its genomic organization. The coding sequence contains 32 exons that extend over 32 kb of the human genome. Most of the introns reside within a region encoding the globular N-terminal domain of the molecule, whereas the entire central rod domain and the entire C-terminal globular domain were found to be encoded by single exons of remarkable length, >3 kb and >6 kb, respectively. Overall, the organization of the human plectin gene was strikingly similar to that of human bullous pemphigoid antigen 1 (BPAG1), confirming that both proteins belong to the same gene family. Comparison of the deduced protein sequences for human and rat plectin revealed that they were 93% identical. By using fluorescence in situ hybridization, we have mapped the plectin gene to the long arm of chromosome 8 within the telomeric region. This gene locus (8q24) has previously been implicated in the human blistering skin disease epidermolysis bullosa simplex Ogna. Detailed knowledge of the structure of the plectin gene and its chromosome localization will aid in the elucidation of whether this or any other pathological conditions are linked to alterations in the plectin gene.

Normal human serum contains a natural IgM antibody cytotoxic for human neuroblastoma cells.

Neuroblastoma (NB) is characterized by the second highest spontaneous regression of any human malignant disorder, a phenomenon that remains to be elucidated. In this study, a survey of 94 normal human adult sera revealed a considerable natural humoral cytotoxicity against human NB cell lines in approximately one-third of the tested sera of both genders. Specific cell killing by these sera was in the range of 40% to 95%. Serum cytotoxicity was dependent on an intact classical pathway of complement. By several lines of evidence, IgM antibodies were identified as the cytotoxic factor in the sera. Further analyses revealed that a 260-kDa protein was recognized by natural IgM of cytotoxic sera in Western blots of NB cell extracts. The antigen was expressed on the surface of seven human NB cell lines but not on human melanoma or other control tumor cell lines derived from kidney, pancreas, colon, bone, skeletal muscle, lymphatic system, and bone marrow. Furthermore, no reactivity was observed with normal human fibroblasts, melanocytes, and epidermal keratinocytes. The antigen was expressed in vivo as detected by immunohistochemistry in both the tumor of a NB patient and NB tumors established in nude rats from human NB cell lines. Most interestingly, the IgM anti-NB antibody was absent from the sera of 11 human NB patients with active disease. The anti-NB IgM also could not be detected in tumor tissue obtained from a NB patient. Collectively, our data suggest the existence of a natural humoral immunological tumor defense mechanism, which could account for the in vivo phenomenon of spontaneous NB tumor regression.

A polygenic mouse model of psoriasiform skin disease in CD18-deficient mice.

Previously, a hypomorphic mutation in CD18 was generated by gene targeting, with homozygous mice displaying increased circulating neutrophil counts, defects in the response to chemically induced peritonitis, and delays in transplantation rejection. When this mutation was backcrossed onto the PL/J inbred strain, virtually all homozygous mice developed a chronic inflammatory skin disease with a mean age of onset of 11 weeks after birth. The disease was characterized by erythema, hair loss, and the development of scales and crusts. The histopathology revealed hyperplasia of the epidermis, subcorneal microabscesses, orthohyperkeratosis, parakeratosis, and lymphocyte exocytosis, which are features in common with human psoriasis and other hyperproliferative inflammatory skin disorders. Repetitive cultures failed to demonstrate bacterial or fungal organisms potentially involved in the pathogenesis of this disease, and the dermatitis resolved rapidly after subcutaneous administration of dexamethasone. Homozygous mutant mice on a (PL/J x C57BL/6J)F1 background did not develop the disease and backcross experiments suggest that a small number of genes (perhaps as few as one), in addition to CD18, determine susceptibility to the disorder. This phenotype provides a model for inflammatory skin disorders, may have general relevance to polygenic human inflammatory diseases, and should help to identify genes that interact with the beta2 integrins in inflammatory processes.

Self-renewal of primitive human hematopoietic cells (long-term-culture-initiating cells) in vitro and their expansion in defined medium.

A major goal of experimental and clinical hematology is the identification of mechanisms and conditions that support the expansion of transplantable hematopoietic stem cells. In normal marrow, such cells appear to be identical to (or represent a subset of) a population referred to as long-term-culture-initiating cells (LTC-ICs) so-named because of their ability to produce colony-forming cell (CFC) progeny for > or = 5 weeks when cocultured with stromal fibroblasts. Some expansion of LTC-ICs in vitro has recently been described, but identification of the factors required and whether LTC-IC self-renewal divisions are involved have remained unresolved issues. To address these issues, we examined the maintenance and/or generation of LTC-ICs from single CD34+ CD38- cells cultured for variable periods under different culture conditions. Analysis of the progeny obtained from cultures containing a feeder layer of murine fibroblasts engineered to produce steel factor, interleukin (IL)-3, and granulocyte colony-stimulating factor showed that approximately 20% of the input LTC-ICs (representing approximately 2% of the original CD34+ CD38- cells) executed self-renewal divisions within a 6-week period. Incubation of the same CD34+ CD38- starting populations as single cells in a defined (serum free) liquid medium supplemented with Flt-3 ligand, steel factor, IL-3, IL-6, granulocyte colony-stimulating factor, and nerve growth factor resulted in the proliferation of initial cells to produce clones of from 4 to 1000 cells within 10 days, approximately 40% of which included > or = 1 LTC-IC. In contrast, in similar cultures containing methylcellulose, input LTC-ICs appeared to persist but not divide. Overall the LTC-IC expansion in the liquid cultures was 30-fold in the first 10 days and 50-fold by the end of another 1-3 weeks. Documentation of human LTC-IC self-renewal in vitro and identification of defined conditions that permit their extensive and rapid amplification should facilitate analysis of the molecular mechanisms underlying these processes and their exploitation for a variety of therapeutic applications.

Early p53 alterations in mouse skin carcinogenesis by UVB radiation: immunohistochemical detection of mutant p53 protein in clusters of preneoplastic epidermal cells.

High levels of the p53 protein are immunohistochemically detectable in a majority of human nonmelanoma skin cancers and UVB-induced murine skin tumors. These increased protein levels are often associated with mutations in the conserved domains of the p53 gene. To investigate the timing of the p53 alterations in the process of UVB carcinogenesis, we used a well defined murine model (SKH:HR1 hairless mice) in which the time that tumors appear is predictable from the UVB exposures. The mice were subjected to a series of daily UVB exposures, either for 17 days or for 30 days, which would cause skin tumors to appear around 80 or 30 weeks, respectively. In the epidermis of these mice, we detected clusters of cells showing a strong immunostaining of the p53 protein, as measured with the CM-5 polyclonal antiserum. This cannot be explained by transient accumulation of the normal p53 protein as a physiological response to UVB-induced DNA damage. In single exposure experiments the observed transient CM-5 immunoreactivity lasted for only 3 days and was not clustered, whereas these clusters were still detectable as long as 56 days after 17 days of UVB exposure. In addition, approximately 70% of these patches reacted with the mutant-specific monoclonal antibody PAb240, whereas transiently induced p53-positive cells did not. In line with indicative human data, these experimental results in the hairless mouse model unambiguously demonstrate that constitutive p53 alterations are causally related to chronic UVB exposure and that they are a very early event in the induction of skin cancer by UVB radiation.

Production of avian leukosis virus particles in mammalian cells can be mediated by the interaction of the human immunodeficiency virus protein Rev and the Rev-responsive element.

In human immunodeficiency virus type 1-infected cells, the efficient expression of viral proteins from unspliced and singly spliced RNAs is dependent on two factors: the presence in the cell of the viral protein Rev and the presence in the viral RNA of the Rev-responsive element (RRE). We show here that the HIV-1 Rev/RRE system can increase the expression of avian leukosis virus (ALV) structural proteins in mammalian cells (D-17 canine osteosarcoma) and promote the release of mature ALV virions from these cells. In this system, the Rev/RRE interaction appears to facilitate the export of full-length unspliced ALV RNA from the nucleus to the cytoplasm, allowing increased production of the ALV structural proteins. Gag protein is produced in the cytoplasm of the ALV-transfected cells even in the absence of a Rev/RRE interaction. However, a functional Rev/RRE interaction increases the amount of Gag present intracellularly and, more strikingly, results in the release of mature ALV particles into the supernatant. RCAS virus containing an RRE is replication-competent in chicken embryo fibroblasts; however, we have been unable to determine whether the particles produced in D-17 cells are as infectious as the particles produced in chicken embryo fibroblasts.

Point mutation of the autophosphorylation site or in the nuclear location signal causes protein kinase A RII beta regulatory subunit to lose its ability to revert transformed fibroblasts.

The RII beta regulatory subunit of cAMP-dependent protein kinase (PKA) contains an autophosphorylation site and a nuclear location signal, KKRK. We approached the structure-function analysis of RII beta by using site-directed mutagenesis. Ser114 (the autophosphorylation site) of human RII beta was replaced with Ala (RII beta-P) or Arg264 of KKRK was replaced with Met (RII beta-K). ras-transformed NIH 3T3 (DT) cells were transfected with expression vectors for RII beta, RII beta-P, and RII beta-K, and the effects on PKA isozyme distribution and transformation properties were analyzed. DT cells contained PKA-I and PKA-II isozymes in a 1:2 ratio. Over-expression of wild-type or mutant RII beta resulted in an increase in PKA-II and the elimination of PKA-I. Only wild-type RII beta cells demonstrated inhibition of both anchorage-dependent and -independent growth and phenotypic change. The growth inhibitory effect of RII beta overexpression was not due to suppression of ras expression but was correlated with nuclear accumulation of RII beta. DT cells demonstrated growth inhibition and phenotypic change upon treatment with 8-Cl-cAMP. RII beta-P or RII beta-K cells failed to respond to 8-Cl-cAMP. These data suggest that autophosphorylation and nuclear location signal sequences are integral parts of the growth regulatory mechanism of RII beta.

Protective immune responses induced by secretion of a chimeric soluble protein from a recombinant Mycobacterium bovis bacillus Calmette-Guérin vector candidate vaccine for human immunodeficiency virus type 1 in small animals.

A recombinant Mycobacterium bovis bacillus Calmette-Guérin (BCG) vector-based vaccine that secretes the V3 principal neutralizing epitope of human immunodeficiency virus (HIV) could induce immune response to the epitope and prevent the viral infection. By using the Japanese consensus sequence of HIV-1, we successfully constructed chimeric protein secretion vectors by selecting an appropriate insertion site of a carrier protein and established the principal neutralizing determinant (PND)-peptide secretion system in BCG. The recombinant BCG (rBCG)-inoculated guinea pigs were initially screened by delayed-type hypersensitivity (DTH) skin reactions to the PND peptide, followed by passive transfer of the DTH by the systemic route. Further, immunization of mice with the rBCG resulted in induction of cytotoxic T lymphocytes. The guinea pig immune antisera showed elevated titers to the PND peptide and neutralized HIVMN, and administration of serum IgG from the vaccinated guinea pigs was effective in completely blocking the HIV infection in thymus/liver transplanted severe combined immunodeficiency (SCID)/hu or SCID/PBL mice. In addition, the immune serum IgG was shown to neutralize primary field isolates of HIV that match the neutralizing sequence motif by a peripheral blood mononuclear cell-based virus neutralization assay. The data support the idea that the antigen-secreting rBCG system can be used as a tool for development of HIV vaccines.

Cloning and characterization of a cellular apoptosis susceptibility gene, the human homologue to the yeast chromosome segregation gene CSE1.

We recently isolated human cDNA fragments that render MCF-7 breast cancer cells resistant to cell death caused by Pseudomonas exotoxin, Pseudomonas exotoxin-derived immunotoxins, diphtheria toxin, and tumor necrosis factor. We report here that one of these fragments is an antisense fragment of a gene homologous to the essential yeast chromosome segregation gene CSE1. Cloning and analysis of the full-length cDNA of the human CSE1 homologue, which we name CAS for cellular apoptosis susceptibility gene, reveals a protein coding region with similar length (971 amino acids for CAS, 960 amino acids for CSE1) and 59% overall protein homology to the yeast CSE1 protein. The conservation of this gene indicates it has an important function in human cells consistent with the essential role of CSE1 in yeast. CAS is highly expressed in human tumor cell lines and in human testis and fetal liver, tissues that contain actively dividing cells. Furthermore, CAS expression increases when resting human fibroblasts are induced to proliferate and decreases when they are growth-arrested. Thus, CAS appears to play an important role in both toxin and tumor necrosis factor-mediated cell death, as well as in cell proliferation.

Platelet-derived growth factor stimulates the secretion of hyaluronic acid by proliferating human vascular smooth muscle cells.

Total glycans from the cell layer and the culture medium of human vascular smooth muscle cells (VSMC) that had been cultivated in the presence of platelet-derived growth factor (PDGF) were isolated and purified by gel filtration after Pronase and DNase digestion and alkaliborohydride treatment. Measurements of the content of neutral hexoses and uronic acids revealed that PDGF stimulates total glycan synthesis by proliferating VSMC in a linear fashion from 24 h to 72 h of incubation. In contrast, total glycan synthesis by human fibroblasts, epithelial cells, or endothelial cells was not affected by PDGF, indicating cell-type specificity. Chemical, biochemical, and enzymological characterization of the total glycans synthesized by VSMC showed that PDGF stimulates the secretion of a 340-kDa glycan molecule in a time-dependent manner from 24 h to 72 h. This molecule is highly acidic, shares a common structure with hyaluronic acid, and exhibits a potent antiproliferative activity on VSMC. These results suggest that VSMC in response to PDGF are capable of controlling their own growth and migration by the synthesis of a specific form of hyaluronic acid with antiproliferative potency, which may be involved in the regulation of the local inflammatory responses associated with atherosclerosis.

On the mechanism of skin wound "contraction": a granulation tissue "knockout" with a normal phenotype.

This report explores the mechanism of spontaneous closure of full-thickness skin wounds. The domestic pig, often used as a human analogue for skin wound repair studies, closes these wounds with kinetics similar to those in the guinea pig (mobile skin), even though the porcine dermis on the back is thick and nearly immobile. In the domestic pig, as in the guinea pig, daily full-thickness excisions of the central granulation tissue up to but not including the wound edges in both back and flank wounds do not alter the rate or completeness of wound closure or the final pattern of the scar. A purse-string mechanism of closure was precluded by showing that surgical interruption of wound edge continuity does not alter closure kinetics or wound shape. We conclude that "tightness" of skin is not a key factor nor is the central granulation tissue required for normal wound closure. These data imply that in vitro models such as contraction of isolated granulation tissue or of the cell-populated collagen lattice may not be relevant for understanding the cell biology of in vivo wound closure. Implications for the mechanism for wound closure are discussed.

CD40 on human endothelial cells: inducibility by cytokines and functional regulation of adhesion molecule expression.

Cultured human umbilical vein endothelial cells (EC) constitutively express a low level of CD40 antigen as detected by monoclonal antibody binding and fluorescence flow cytometric quantitation. The level of expression on EC is increased about 3-fold following 24 h treatment with optimal concentrations of tumor necrosis factor, interleukin 1, interferon beta, or interferon gamma; both interferons show greater than additive induction of CD40 when combined with tumor necrosis factor or interleukin 1. Expression of CD40 increases within 8 h of cytokine treatment and continues to increase through 72 h. A trimeric form of recombinant murine CD40 ligand acts on human EC to increase expression of leukocyte adhesion molecules, including E-selectin, vascular cell adhesion molecule 1, and intercellular adhesion molecule 1. CD40 may be detected immunocytochemically on human microvascular EC in normal skin. We conclude that endothelial CD40 may play a role as a signaling receptor in the development of T-cell-mediated inflammatory reactions.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.