Parvovirus B19 promoter at map unit 6 confers autonomous replication competence and erythroid specificity to adeno-associated virus 2 in primary human hematopoietic progenitor cells.

The pathogenic human parvovirus B19 is an autonomously replicating virus with a remarkable tropism for human erythroid progenitor cells. Although the target cell specificity for B19 infection has been suggested to be mediated by the erythrocyte P-antigen receptor (globoside), a number of nonerythroid cells that express this receptor are nonpermissive for B19 replication. To directly test the role of expression from the B19 promoter at map unit 6 (B19p6) in the erythroid cell specificity of B19, we constructed a recombinant adeno-associated virus 2 (AAV), in which the authentic AAV promoter at map unit 5 (AAVp5) was replaced by the B19p6 promoter. Although the wild-type (wt) AAV requires a helper virus for its optimal replication, we hypothesized that inserting the B19p6 promoter in a recombinant AAV would permit autonomous viral replication, but only in erythroid progenitor cells. In this report, we provide evidence that the B19p6 promoter is necessary and sufficient to impart autonomous replication competence and erythroid specificity to AAV in primary human hematopoietic progenitor cells. Thus, expression from the B19p6 promoter plays an important role in post-P-antigen receptor erythroid-cell specificity of parvovirus B19. The AAV-B19 hybrid vector system may also prove to be useful in potential gene therapy of human hemoglobinopathies.

Mutagenesis of palmitoylation sites in endothelial nitric oxide synthase identifies a novel motif for dual acylation and subcellular targeting.

The endothelial nitric oxide synthase (ec-NOS) plays a key role in the transduction of signals from the bloodstream to the underlying smooth muscle. ecNOS undergoes a complex series of covalent modifications, including myristoylation and palmitoylation, which appear to play a role in ecNOS membrane association. Mutagenesis of the myristoylation site, which prevents both myristoylation and palmitoylation, blocks ecNOS targeting to cell membranes. Further, as described for some G-protein alpha subunits, both membrane association and palmitoylation of ecNOS are dynamically regulated: in response to agonists, the enzyme undergoes partial redistribution to the cell cytosol concomitant with depalmitoylation. To clarify the role of palmitoylation in determining ecNOS subcellular localization, we have constructed palmitoylation-deficient mutants of ecNOS. Serine was substituted for cysteine at two potential palmitoylation sites (Cys-15 and Cys-26) by site-directed mutagenesis. Immunoprecipitation of ecNOS mutants following cDNA transfection and biosynthetic labeling with [3H]palmitate revealed that mutagenesis of either cysteine residue attenuated palmitoylation, whereas replacement of both residues completely eliminated palmitoylation. Analysis of N-terminal deletion mutations of ecNOS demonstrated that the region containing these two cysteine residues is both necessary and sufficient for enzyme palmitoylation. The cysteines thus identified as the palmitoylation sites for ecNOS are separated by an unusual (Gly-Leu)5 sequence and appear to define a sequence motif for dual acylation. We analyzed the subcellular distribution of ecNOS mutants by differential ultracentrifugation and found that mutagenesis of the ecNOS palmitoylation sites markedly reduced membrane association of the enzyme. These results document that ecNOS palmitoylation is an important determinant for the subcellular distribution of ecNOS and identify a new motif for the reversible palmitoylation of signaling proteins.

Survival and differentiation of adult neuronal progenitor cells transplanted to the adult brain.

The dentate gyrus of the hippocampus is one of the few areas of the adult brain that undergoes neurogenesis. In the present study, cells capable of proliferation and neurogenesis were isolated and cultured from the adult rat hippocampus. In defined medium containing basic fibroblast growth factor (FGF-2), cells can survive, proliferate, and express neuronal and glial markers. Cells have been maintained in culture for 1 year through multiple passages. These cultured adult cells were labeled in vitro with bromodeoxyuridine and adenovirus expressing beta-galactosidase and were transplanted to the adult rat hippocampus. Surviving cells were evident through 3 months postimplantation with no evidence of tumor formation. Within 2 months postgrafting, labeled cells were found in the dentate gyrus, where they differentiated into neurons only in the intact region of the granule cell layer. Our results indicate that FGF-2 responsive progenitors can be isolated from the adult hippocampus and that these cells retain the capacity to generate mature neurons when grafted into the adult rat brain.

Suppression of retinal neovascularization in vivo by inhibition of vascular endothelial growth factor (VEGF) using soluble VEGF-receptor chimeric proteins.

The majority of severe visual loss in the United States results from complications associated with retinal neovascularization in patients with ischemic ocular diseases such as diabetic retinopathy, retinal vein occlusion, and retinopathy of prematurity. Intraocular expression of the angiogenic protein vascular endothelial growth factor (VEGF) is closely correlated with neovascularization in these human disorders and with ischemia-induced retinal neovascularization in mice. In this study, we evaluated whether in vivo inhibition of VEGF action could suppress retinal neovascularization in a murine model of ischemic retinopathy. VEGF-neutralizing chimeric proteins were constructed by joining the extracellular domain of either human (Flt) or mouse (Flk) high-affinity VEGF receptors with IgG. Control chimeric proteins that did not bind VEGF were also used. VEGF-receptor chimeric proteins eliminated in vitro retinal endothelial cell growth stimulation by either VEGF (P < 0.006) or hypoxic conditioned medium (P < 0.005) without affecting growth under nonstimulated conditions. Control proteins had no effect. To assess in vivo response, animals with bilateral retinal ischemia received intravitreal injections of VEGF antagonist in one eye and control protein in the contralateral eye. Retinal neovascularization was quantitated histologically by a masked protocol. Retinal neovascularization in the eye injected with human Flt or murine Flk chimeric protein was reduced in 100% (25/25; P < 0.0001) and 95% (21/22; P < 0.0001) 0.0001) of animals, respectively, compared to the control treated eye. This response was evident after only a single intravitreal injection and was dose dependent with suppression of neovascularization noted after total delivery of 200 ng of protein (P < 0.002). Reduction of histologically evident neovascular nuclei per 6-microns section averaged 47% +/- 4% (P < 0.001) and 37% +/- 2% (P < 0.001) for Flt and Flk chimeric proteins with maximal inhibitory effects of 77% and 66%, respectively. No retinal toxicity was observed by light microscopy. These data demonstrate VEGF's causal role in retinal angiogenesis and prove the potential of VEGF inhibition as a specific therapy for ischemic retinal disease.

Exogenous vascular endothelial growth factor induces malformed and hyperfused vessels during embryonic neovascularization.

Vascular endothelial growth factor (VEGF) is a potent and specific endothelial mitogen that is able to induce angiogenesis in vivo [Leung, D. W., Cachianes, G., Kuang, W.-J., Goeddel, D. V. & Ferrara, N. (1989) Science 246 1306-1309]. To determine if VEGF also influences the behavior of primordial endothelial cells, we used an in vivo vascular assay based on the de novo formation of vessels. Japanese quail embryos injected with nanomolar quantities of the 165-residue form of VEGF at the onset of vasculogenesis exhibited profoundly altered vessel development. In fact, the overall patterning of the vascular network was abnormal in all VEGF-injected embryos. The malformations were attributable to two specific endothelial cell activities: (i) inappropriate neovascularization in normally avascular areas and (ii) the unregulated, excessive fusion of vessels. In the first instance, supernumerary vessels directly linked the inflow channel of the heart to the aortic outflow channel. The second aberrant activity led to the formation of vessels with abnormally large lumens. Ultimately, unregulated vessel fusion generated massive vascular sacs that obliterated the identity of individual vessels. These observations show that exogenous VEGF has an impact on the behavior of primordial endothelial cells engaged in vasculogenesis, and they strongly suggest that endogenous VEGF is important in vascular patterning and regulation of vessel size (lumen formation).

Platelets roll on stimulated endothelium in vivo: an interaction mediated by endothelial P-selectin.

P-selectin, found in storage granules of platelets and endothelial cells, can be rapidly expressed upon stimulation. Mice lacking this membrane receptor exhibit a severe impairment of leukocyte rolling. We observed that, in addition to leukocytes, platelets were rolling in mesenteric venules of wild-type mice. To investigate the role of P-selectin in this process, resting or activated platelets from wild-type or P-selectin-deficient mice were fluorescently labeled and transfused into recipients of either genotype. Platelet-endothelial interactions were monitored by intravital microscopy. We observed rolling of either wild-type or P-selectin-deficient resting platelets on wild-type endothelium. Endothelial stimulation with the calcium ionophore A23187 increased the number of platelets rolling 4-fold. Activated P-selectin-deficient platelets behaved similarly, whereas activated wild-type platelets bound to leukocytes and were seen rolling together. Platelets of either genotype, resting or activated, interacted minimally with mutant endothelium even after A23187 treatment. The velocity of platelet rolling was 6- to 9-fold greater than that of leukocytes. Our results demonstrate that (i) platelets roll on endothelium in vivo, (ii) this interaction requires endothelial but not platelet P-selectin, and (iii) platelet rolling appears to be independent of platelet activation, indicating constitutive expression of a P-selectin ligand(s) on platelets. We have therefore observed an interesting parallel between platelets and leukocytes in that both of these blood cell types roll on stimulated vessel wall and that this process is dependent on the expression of endothelial P-selectin.

Thrombospondin 1 expression in transformed endothelial cells restores a normal phenotype and suppresses their tumorigenesis.

Murine endothelial cells are readily transformed in a single step by the polyomavirus oncogene encoding middle-sized tumor antigen. These cells (bEND.3) form tumors (hemangiomas) in mice which are lethal in newborn animals. The bEND.3 cells rapidly proliferate in culture and express little or no thrombospondin 1 (TS1). To determine the role of TS1 in regulation of endothelial cell phenotype, we stably transfected bEND.3 cells with a human TS1 expression vector. The cells expressing human TS1 were readily identified by their altered morphology and exhibited a slower growth rate and lower saturation density than the parental bEND.3 cells. The TS1-expressing cells also formed aligned cords of cells instead of clumps or cysts in Matrigel. Moreover, while the bEND.3 cells formed large tumors in nude mice within 48 hr, the TS1-expressing cells failed to form tumors even after 1 month. The TS1-transfected cells expressed transforming growth factor beta mRNA and bioactivity at levels similar to those of the parental or vector-transfected bEND.3 cells, indicating that the effects of TS1 expression are not due to the activation of transforming growth factor beta by TS1. TS1 expression resulted in a > 100-fold decrease in net fibrinolytic (urokinase-type plasminogen activator, uPA) activity due to more plasminogen-activator inhibitor 1 and less uPA secretion. TS1 thus appears to be an important regulator of endothelial cell phenotype required for maintaining the quiescent, differentiated state.

Transfection of the human heme oxygenase gene into rabbit coronary microvessel endothelial cells: protective effect against heme and hemoglobin toxicity.

Heme oxygenase (HO) is a stress protein and has been suggested to participate in defense mechanisms against agents that may induce oxidative injury such as metals, endotoxin, heme/hemoglobin, and various cytokines. Overexpression of HO in cells might therefore protect against oxidative stress produced by certain of these agents, specifically heme and hemoglobin, by catalyzing their degradation to bilirubin, which itself has antioxidant properties. We report here the successful in vitro transfection of rabbit coronary microvessel endothelial cells with a functioning gene encoding the human HO enzyme. A plasmid containing the cytomegalovirus promoter and the human HO cDNA complexed to cationic liposomes (Lipofectin) was used to transfect rabbit endothelial cells. Cells transfected with human HO exhibited an approximately 3.0-fold increase in enzyme activity and expressed a severalfold induction of human HO mRNA as compared with endogenous rabbit HO mRNA. Transfected and nontransfected cells expressed factor VIII antigen and exhibited similar acetylated low-density lipoprotein uptake (two important features that characterize endothelial cells) with > 85% of cells staining positive for each marker. Moreover, cells transfected with the human HO gene acquired substantial resistance to toxicity produced by exposure to recombinant hemoglobin and heme as compared with nontransfected cells. The protective effect of HO overexpression against heme/hemoglobin toxicity in endothelial cells shown in these studies provides direct evidence that the inductive response of human HO to such injurious stimuli represents an important tissue adaptive mechanism for moderating the severity of cell damage produced by these blood components.

Leukocytes express connexin 43 after activation with lipopolysaccharide and appear to form gap junctions with endothelial cells after ischemia-reperfusion.

Levels and subcellular distribution of connexin 43 (Cx43), a gap junction protein, were studied in hamster leukocytes before and after activation with endotoxin (lipopolysaccharide, LPS) both in vitro and in vivo. Untreated leukocytes did not express Cx43. However, Cx43 was clearly detectable by indirect immunofluorescence in cells treated in vitro with LPS (1 micrograms/ml, 3 hr). Cx43 was also detected in leukocytes obtained from the peritoneal cavity 5-7 days after LPS-induced inflammation. In some leukocytes that formed clusters Cx43 immunoreactivity was present at appositional membranes, suggesting formation of homotypic gap junctions. In cell homogenates of activated peritoneal macrophages, Cx43, detected by Western blot analysis, was mostly unphosphorylated. A second in vivo inflammatory condition studied was that induced by ischemia-reperfusion of the hamster cheek pouch. In this system, leukocytes that adhered to venular endothelial cells after 1 hr of ischemia, followed by 1 hr of reperfusion, expressed Cx43. Electron microscope observations revealed small close appositions, putative gap junctions, at leukocyte-endothelial cell and leukocyte-leukocyte contacts. These results indicate that the expression of Cx43 can be induced in leukocytes during an inflammatory response which might allow for heterotypic or homotypic intercellular gap junctional communication. Gap junctions may play a role in leukocyte extravasation.

Identification of endothelin 1 and big endothelin 1 in secretory vesicles isolated from bovine aortic endothelial cells.

Vesicles containing endothelin 1 (ET-1) were isolated from bovine aortic endothelial cells (BAECs) by fractionation of homogenates on sucrose density gradients by ultracentrifugation. The vesicles were localized at the 1.0/1.2 M sucrose interface using a specific anti-ET-1-(16-21) RIA. Identification of ET-1 and big ET-1 in this fraction was confirmed by HPLC analysis combined with RIA. Morphological examination of the ET-1-enriched fraction by electron microscopy identified clusters of vesicles approximately 100 nm in diameter. Immunostaining of ultrathin cryosections prepared from the vesicle fraction for ET-1 or big ET-1 showed clusters of 15-nm gold particles attached to or within vesicles. Immunofluorescence staining of whole BAECs using a specific ET-1-(16-21) IgG purified by affinity chromatography revealed punctate granulation of the cell cytoplasm viewed under light microscopy. This distinct pattern of staining was shown by confocal light microscopy to be intracellular. Immunofluorescence staining of whole cells with a polyclonal antiserum for big ET-1-(22-39) showed a defined perinuclear localization of precursor molecule. Hence, several different approaches have demonstrated that ET-1 and big ET-1 are localized within intracellular vesicles in BAECs, suggesting that these subcellular compartments are an important site for processing of big ET-1 by endothelin-converting enzyme.

CD40 on human endothelial cells: inducibility by cytokines and functional regulation of adhesion molecule expression.

Cultured human umbilical vein endothelial cells (EC) constitutively express a low level of CD40 antigen as detected by monoclonal antibody binding and fluorescence flow cytometric quantitation. The level of expression on EC is increased about 3-fold following 24 h treatment with optimal concentrations of tumor necrosis factor, interleukin 1, interferon beta, or interferon gamma; both interferons show greater than additive induction of CD40 when combined with tumor necrosis factor or interleukin 1. Expression of CD40 increases within 8 h of cytokine treatment and continues to increase through 72 h. A trimeric form of recombinant murine CD40 ligand acts on human EC to increase expression of leukocyte adhesion molecules, including E-selectin, vascular cell adhesion molecule 1, and intercellular adhesion molecule 1. CD40 may be detected immunocytochemically on human microvascular EC in normal skin. We conclude that endothelial CD40 may play a role as a signaling receptor in the development of T-cell-mediated inflammatory reactions.

Human von Willebrand factor gene sequences target expression to a subpopulation of endothelial cells in transgenic mice.

The present study was undertaken to define the 5' and 3' regulatory sequences of human von Willebrand factor gene that confer tissue-specific expression in vivo. Transgenic mice were generated bearing a chimeric construct that included 487 bp of 5' flanking sequence and the first exon fused in-frame to the Escherichia coli lacZ gene. In situ histochemical analyses in independent lines demonstrated that the von Willebrand factor promoter targeted expression of LacZ to a subpopulation of endothelial cells in the yolk sac and adult brain. LacZ activity was absent in the vascular beds of the spleen, lung, liver, kidney, testes, heart, and aorta, as well as in megakaryocytes. In contrast, in mice containing the lacZ gene targeted to the thrombomodulin locus, the 5-bromo-4-chloro-3-indolyl beta-D-galactopyranoside reaction product was detected throughout the vascular tree. These data highlight the existence of regional differences in endothelial cell gene regulation and suggest that the 733-bp von Willebrand factor promoter may be useful as a molecular marker to investigate endothelial cell diversity.

Hypoxia-mediated induction of acidic/basic fibroblast growth factor and platelet-derived growth factor in mononuclear phagocytes stimulates growth of hypoxic endothelial cells.

Wound repair and tumor vascularization depend upon blood vessel growth into hypoxic tissue. Although hypoxia slows endothelial cell (EC) proliferation and suppresses EC basic fibroblast growth factor (bFGF) expression, we report that macrophages (MPs) exposed to PO2 approximately 12-14 torr (1 torr = 133.3 Pa) synthesize and release in a time-dependent manner platelet-derived growth factor (PDGF) and acidic/basic FGFs (a/bFGFs), which stimulate the growth of hypoxic ECs. Chromatography of hypoxic MP-conditioned medium on immobilized heparin with an ascending NaCl gradient resolved three peaks of mitogenic activity: activity of the first peak was neutralized by antibody to PDGF; activity of the second peak was neutralized by antibody to aFGF; and activity of the third peak was neutralized by antibody to bFGF. Metabolically labeled lysates and supernatants from MPs exposed to hypoxia showed increased synthesis and release of immunoprecipitable PDGF and a/bFGF in the absence of changes in cell viability. Possible involvement of a heme-containing oxygen sensor in MP elaboration of growth factors was suggested by the induction of bFGF and PDGF by normoxic MPs exposed to nickel or cobalt, although metabolic inhibitors such as sodium azide were without effect. These results suggest a paracrine model in which hypoxia stimulates MP release of PDGF and a/bFGF, inducing EC proliferation and potentially promoting angiogenesis in hypoxic environments.

Induction of the gene encoding mucosal vascular addressin cell adhesion molecule 1 by tumor necrosis factor alpha is mediated by NF-kappa B proteins.

Mucosal vascular addressin cell adhesion molecule 1 (MAdCAM-1) is involved in trafficking of lymphocytes to mucosal endothelium. Expression of MAdCAM-1 is induced in the murine endothelial cell line bEnd.3 by tumor necrosis factor alpha (TNF-alpha), interleukin 1, and bacterial lipopolysaccharide. Here we show that TNF-alpha enhances expression of a firefly luciferase reporter directed by the MAdCAM-1 promoter, confirming transcriptional regulation of MAdCAM-1. Mutational analysis of the promoter indicates that a DNA fragment extending from nt -132 to nt +6 of the gene is sufficient for TNF-alpha inducibility. Two regulatory sites critical for TNF-alpha induction were identified in this region. DNA-binding experiments demonstrate that NF-kappa B proteins from nuclear extracts of TNF-alpha-stimulated bEnd.3 cells bind to these sites, and transfection assays with promoter mutants of the MAdCAM-1 gene indicate that occupancy of both sites is essential for promoter function. The predominant NF-kappa B binding activity detected with these nuclear extracts is a p65 homodimer. These findings establish that, as with other endothelial cell adhesion molecules, transcriptional induction of MAdCAM-1 by TNF-alpha requires activated NF-kappa B proteins.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.