875 resultados para Colony algorithms


Relevância:

20.00% 20.00%

Publicador:

Resumo:

To develop a murine model system to test the role of monocyte-derived macrophage in atherosclerosis, the osteopetrotic (op) mutation in the macrophage colony-stimulating factor gene was bred onto the apolipoprotein E (apoE)-deficient background. The doubly mutant (op/apoE-deficient) mice fed a low-fat chow diet had significantly smaller proximal aortic lesions at an earlier stage of progression than their apoE-deficient control littermates. These lesions in the doubly mutant mice were composed of macrophage foam cells. The op/apoE-deficient mice also had decreased body weights, decreased blood monocyte differentials, and increased mean cholesterol levels of approximately 1300 mg/dl. Statistical analysis determined that atherosclerosis lesion area was significantly affected by the op genotype and gender. The confounding variables of body weight, plasma cholesterol, and monocyte differential, which were all affected by op genotype, had no significant additional effect on lesion area once they were adjusted for the effects of op genotype and gender. Unexpectedly, there was a significant inverse correlation between plasma cholesterol and lesion area, implying that each may be the result of a common effect of macrophage colony-stimulating factor levels. The data support the hypothesis that macrophage colony-stimulating factor and its effects on macrophage development and function play a key role in atherogenesis.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Neutrophils in tissue culture spontaneously undergo programmed cell death (apoptosis), a process characterized by well-defined morphological alterations affecting the cell nucleus. We found that these morphological changes were preceded by intracellular acidification and that acidification and the apoptotic changes in nuclear morphology were both delayed by granulocyte colony-stimulating factor (G-CSF). Among the agents that defend neutrophils against intracellular acidification is a vacuolar H(+)-ATPase that pumps protons out of the cytosol. When this proton pump was inhibited by bafilomycin A1, G-CSF no longer protected the neutrophils against apoptosis. We conclude that G-CSF delays apoptosis in neutrophils by up-regulating the cells' vacuolar H(+)-ATPase and that intracellular acidification is an early event in the apoptosis program.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Macrophage colony-stimulating factor (M-CSF) is required for the growth and differentiation of mononuclear phagocytes. In the present studies using human monocytes, we show that M-CSF induces interaction of the Grb2 adaptor protein with the focal adhesion kinase pp125FAK. The results demonstrate that tyrosine-phosphorylated pp125FAK directly interacts with the SH2 domain of Grb2. The findings indicate that a pYENV site at Tyr-925 in pp125FAK is responsible for this interaction. We also demonstrate that the Grb2-FAK complex associates with the GTPase dynamin. Dynamin interacts with the SH3 domains of Grb2 and exhibits M-CSF-dependent tyrosine phosphorylation in association with pp125FAK. These findings suggest that M-CSF-induced signaling involves independent Grb2-mediated pathways, one leading to Ras activation and another involving pp125FAK and a GTPase implicated in receptor internalization.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We observed that when monocyte/macrophage precursors derived from murine bone marrow were treated with macrophage-colony-stimulating factor (M-CSF), there was a dose-dependent increase in both the number of adherent cells and the degree to which the cells were highly spread. Attachment was supported by fibronectin, but not by vitronectin or laminin, suggesting that the integrins alpha 4 beta 1 and/or alpha 5 beta 1 might mediate this event. Binding to fibronectin was blocked partially by antibodies to either integrin, and inhibition was almost complete when the antibodies were used in combination. By a combination of surface labeling with 125I and metabolic labeling with [35S]methionine and [35S]cysteine, we demonstrated that M-CSF treatment led to increased synthesis and surface expression of the two beta 1 integrins. Since attachment to fibronectin and/or stromal cells plays an important role in the maturation of other hematopoietic lineages, we propose that the action of M-CSF in the differentiation of immature monocytes/macrophages includes stimulated expression of the integrins alpha 4 beta 1 and alpha 5 beta 1, leading to interactions with components of the marrow microenvironment necessary for cell maturation.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Pluripotent hematopoietic stem cells (PHSCs) were highly enriched from mouse bone marrow by counterflow centrifugal elutriation, lineage subtraction, and fluorescence-activated cell sorting based on high c-kit receptor expression (c-kitBR). We used reverse transcriptase polymerase chain reaction to assay the c-kitBR subset and the subsets expressing low (c-kitDULL) and no (c-kitNEG) c-kit receptor for expression of mRNA encoding hematopoietic growth factor receptors and transcription factors. The c-kitBR cells had approximately 3.5-fold more c-kit mRNA than unfractionated bone marrow cells. The c-kitDULL cells had 47-58% of the c-kit mRNA found in c-kitBR cells and the c-kitNEG cells had 4-9% of the c-kit mRNA present in c-kitBR cells. By comparing mRNA levels in c-kitBR cells (enriched for PHSCs) with those of unfractionated bone marrow, we demonstrated that c-kitBR cells contained low or undetectable levels of mRNA for c-fms, granulocyte colony-stimulating factor receptor, interleukin 5 receptor (IL-5R), and IL-7R. These same cells had moderate levels of mRNA for erythropoietin receptor, IL-3R subunits IL-3R alpha (SUT-1), AIC-2A, and AIC-2B, IL-6R and its partner gp-130, and the transcription factor GATA-1 and high levels of mRNA for transcription factors GATA-2, p45 NF-E2, and c-myb. We conclude from these findings that PHSCs are programmed to interact with stem cell factor, IL-3, and IL-6 but not with granulocyte or macrophage colony-stimulating factor. These findings also indicate that GATA-2, p45 NF-E2, and c-myb activities may be involved in PHSC maintenance or proliferation.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Comunicación presentada en EVACES 2011, 4th International Conference on Experimental Vibration Analysis for Civil Engineering Structures, Varenna (Lecco), Italy, October 3-5, 2011.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Phase equilibrium data regression is an unavoidable task necessary to obtain the appropriate values for any model to be used in separation equipment design for chemical process simulation and optimization. The accuracy of this process depends on different factors such as the experimental data quality, the selected model and the calculation algorithm. The present paper summarizes the results and conclusions achieved in our research on the capabilities and limitations of the existing GE models and about strategies that can be included in the correlation algorithms to improve the convergence and avoid inconsistencies. The NRTL model has been selected as a representative local composition model. New capabilities of this model, but also several relevant limitations, have been identified and some examples of the application of a modified NRTL equation have been discussed. Furthermore, a regression algorithm has been developed that allows for the advisable simultaneous regression of all the condensed phase equilibrium regions that are present in ternary systems at constant T and P. It includes specific strategies designed to avoid some of the pitfalls frequently found in commercial regression tools for phase equilibrium calculations. Most of the proposed strategies are based on the geometrical interpretation of the lowest common tangent plane equilibrium criterion, which allows an unambiguous comprehension of the behavior of the mixtures. The paper aims to show all the work as a whole in order to reveal the necessary efforts that must be devoted to overcome the difficulties that still exist in the phase equilibrium data regression problem.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We present an algorithm to process images of reflected Placido rings captured by a commercial videokeratoscope. Raw data are obtained with no Cartesian-to-polar-coordinate conversion, thus avoiding interpolation and associated numerical artifacts. The method provides a characteristic equation for the device and is able to process around 6 times more corneal data than the commercial software. Our proposal allows complete control over the whole process from the capture of corneal images until the computation of curvature radii.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In this paper, parallel Relaxed and Extrapolated algorithms based on the Power method for accelerating the PageRank computation are presented. Different parallel implementations of the Power method and the proposed variants are analyzed using different data distribution strategies. The reported experiments show the behavior and effectiveness of the designed algorithms for realistic test data using either OpenMP, MPI or an hybrid OpenMP/MPI approach to exploit the benefits of shared memory inside the nodes of current SMP supercomputers.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Different kinds of algorithms can be chosen so as to compute elementary functions. Among all of them, it is worthwhile mentioning the shift-and-add algorithms due to the fact that they have been specifically designed to be very simple and to save computer resources. In fact, almost the only operations usually involved with these methods are additions and shifts, which can be easily and efficiently performed by a digital processor. Shift-and-add algorithms allow fairly good precision with low cost iterations. The most famous algorithm belonging to this type is CORDIC. CORDIC has the capability of approximating a wide variety of functions with only the help of a slight change in their iterations. In this paper, we will analyze the requirements of some engineering and industrial problems in terms of type of operands and functions to approximate. Then, we will propose the application of shift-and-add algorithms based on CORDIC to these problems. We will make a comparison between the different methods applied in terms of the precision of the results and the number of iterations required.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Background and objective: In this paper, we have tested the suitability of using different artificial intelligence-based algorithms for decision support when classifying the risk of congenital heart surgery. In this sense, classification of those surgical risks provides enormous benefits as the a priori estimation of surgical outcomes depending on either the type of disease or the type of repair, and other elements that influence the final result. This preventive estimation may help to avoid future complications, or even death. Methods: We have evaluated four machine learning algorithms to achieve our objective: multilayer perceptron, self-organizing map, radial basis function networks and decision trees. The architectures implemented have the aim of classifying among three types of surgical risk: low complexity, medium complexity and high complexity. Results: Accuracy outcomes achieved range between 80% and 99%, being the multilayer perceptron method the one that offered a higher hit ratio. Conclusions: According to the results, it is feasible to develop a clinical decision support system using the evaluated algorithms. Such system would help cardiology specialists, paediatricians and surgeons to forecast the level of risk related to a congenital heart disease surgery.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Software for video-based multi-point frequency measuring and mapping: http://hdl.handle.net/10045/53429

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Bracketed annotation made by John Langdon Sibley in Feb. 1842: "The books on this & the three succeeding pages, I find on examination, to have been given by Gov. Bernard." On the fourth page, presumably also in 1842, Sibley wrote: "This is a list of donations by Gov. Bernard, & not by Hollis."

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A motion that the case not be tried in Suffolk County, on the grounds that the judges and jurors were residents of the colony. Pratt was attorney to Paxton, an attorney and commissioner of customs, who had incurred a debt to the Colony.