959 resultados para nutrient solutions
Resumo:
A finite-difference scheme based on flux difference splitting is presented for the solution of the two-dimensional shallow-water equations of ideal fluid flow. A linearised problem, analogous to that of Riemann for gasdynamics, is defined and a scheme, based on numerical characteristic decomposition, is presented for obtaining approximate solutions to the linearised problem. The method of upwind differencing is used for the resulting scalar problems, together with a flux limiter for obtaining a second-order scheme which avoids non-physical, spurious oscillations. An extension to the two-dimensional equations with source terms, is included. The scheme is applied to a dam-break problem with cylindrical symmetry.
Resumo:
A one-dimensional shock (bore) reflection problem is discussed for the two-dimensional shallow water equations with cylindrical symmetry. The differential equations for a similarity solution are derived and solved numerically in conjunction with the Rankine-Hugoniot shock relations.
Resumo:
Solutions of a two-dimensional dam break problem are presented for two tailwater/reservoir height ratios. The numerical scheme used is an extension of one previously given by the author [J. Hyd. Res. 26(3), 293–306 (1988)], and is based on numerical characteristic decomposition. Thus approximate solutions are obtained via linearised problems, and the method of upwind differencing is used for the resulting scalar problems, together with a flux limiter for obtaining a second order scheme which avoids non-physical, spurious oscillations.
Resumo:
A one-dimensional shock-reflection test problem in the case of slab, cylindrical or spherical symmetry is discussed for multi-component flows. The differential equations for a similarity solution are derived and then solved numerically in conjunction with the Rankine-Hugoniot shock relations.
Resumo:
Acetyl-CoA carboxylase β (ACC2) plays a key role in fatty acid synthesis and oxidation pathways. Disturbance of these pathways is associated with impaired insulin responsiveness and metabolic syndrome (MetS). Gene-nutrient interactions may affect MetS risk. This study determined the relationship between ACC2 polymorphisms (rs2075263, rs2268387, rs2284685, rs2284689, rs2300453, rs3742023, rs3742026, rs4766587, and rs6606697) and MetS risk, and whether dietary fatty acids modulate this in the LIPGENE-SU.VI.MAX study of MetS cases and matched controls (n = 1754). Minor A allele carriers of rs4766587 had increased MetS risk (OR 1.29 [CI 1.08, 1.58], P = 0.0064) compared with the GG homozygotes, which may in part be explained by their increased body mass index (BMI), abdominal obesity, and impaired insulin sensitivity (P < 0.05). MetS risk was modulated by dietary fat intake (P = 0.04 for gene-nutrient interaction), where risk conferred by the A allele was exacerbated among individuals with a high-fat intake (>35% energy) (OR 1.62 [CI 1.05, 2.50], P = 0.027), particularly a high intake (>5.5% energy) of n-6 polyunsaturated fat (PUFA) (OR 1.82 [CI 1.14, 2.94], P = 0.01; P = 0.05 for gene-nutrient interaction). Saturated and monounsaturated fat intake did not modulate MetS risk. Importantly, we replicated some of these findings in an independent cohort. In conclusion, the ACC2 rs4766587 polymorphism influences MetS risk, which was modulated by dietary fat, suggesting novel gene-nutrient interactions.
Resumo:
Assimilation of physical variables into coupled physical/biogeochemical models poses considerable difficulties. One problem is that data assimilation can break relationships between physical and biological variables. As a consequence, biological tracers, especially nutrients, are incorrectly displaced in the vertical, resulting in unrealistic biogeochemical fields. To prevent this, we present the idea of applying an increment to the nutrient field within a data assimilating model to ensure that nutrient-potential density relationships are maintained within a water column during assimilation. After correcting the nutrients, it is assumed that other biological variables rapidly adjust to the corrected nutrient fields. We applied this method to a 17 year run of the 2° NEMO ocean-ice model coupled to the PlankTOM5 ecosystem model. Results were compared with a control with no assimilation, and with a model with physical assimilation but no nutrient increment. In the nutrient incrementing experiment, phosphate distributions were improved both at high latitudes and at the equator. At midlatitudes, assimilation generated unrealistic advective upwelling of nutrients within the boundary currents, which spread into the subtropical gyres resulting in more biased nutrient fields. This result was largely unaffected by the nutrient increment and is probably due to boundary currents being poorly resolved in a 2° model. Changes to nutrient distributions fed through into other biological parameters altering primary production, air-sea CO2 flux, and chlorophyll distributions. These secondary changes were most pronounced in the subtropical gyres and at the equator, which are more nutrient limited than high latitudes.
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Resumo:
Long-chain acyl CoA synthetase 1 (ACSL1) plays an important role in fatty acid metabolism and triacylglycerol (TAG) synthesis. Disturbance of these pathways may result in dyslipidemia and insulin resistance, hallmarks of the metabolic syndrome (MetS). Dietary fat is a key environmental factor that may interact with genetic determinants of lipid metabolism to affect MetS risk. We investigated the relationship between ACSL1 polymorphisms (rs4862417, rs6552828, rs13120078, rs9997745, and rs12503643) and MetS risk and determined potential interactions with dietary fat in the LIPGENE-SU.VI.MAX study of MetS cases and matched controls (n = 1,754). GG homozygotes for rs9997745 had increased MetS risk {odds ratio (OR) 1.90 [confidence interval (CI) 1.15, 3.13]; P = 0.01}, displayed elevated fasting glucose (P = 0.001) and insulin concentrations (P = 0.002) and increased insulin resistance (P = 0.03) relative to the A allele carriers. MetS risk was modulated by dietary fat, whereby the risk conferred by GG homozygosity was abolished among individuals consuming either a low-fat (<35% energy) or a high-PUFA diet (>5.5% energy). In conclusion, ACSL1 rs9997745 influences MetS risk, most likely via disturbances in fatty acid metabolism, which was modulated by dietary fat consumption, particularly PUFA intake, suggesting novel gene-nutrient interactions.
Resumo:
This study explores the implications of an organization moving toward service-dominant logic (S-D logic) on the sales function. Driven by its customers’ needs, a service orientation by its nature requires personal interaction and sales personnel are in an ideal position to develop offerings with the customer. However, the development of S-D logic may require sales staff to develop additional skills. Employing a single case study, the study identified that sales personnel are quick to appreciate the advantages of S-D logic for customer satisfaction and six specific skills were highlighted and explored. Further, three propositions were identified: in an organization adopting S-D logic, the sales process needs to elicit needs at both embedded-value and value-in-use levels. In addition, the sales process needs to coproduce not just goods and service attributes but also attributes of the customer’s usage processes. Further, the sales process needs to coproduce not just goods and service attributes but also attributes of the customer’s usage processes.
Resumo:
This paper represents the last technical contribution of Professor Patrick Parks before his untimely death in February 1995. The remaining authors of the paper, which was subsequently completed, wish to dedicate the article to Patrick. A frequency criterion for the stability of solutions of linear difference equations with periodic coefficients is established. The stability criterion is based on a consideration of the behaviour of a frequency hodograph with respect to the origin of coordinates in the complex plane. The formulation of this criterion does not depend on the order of the difference equation.
Resumo:
A study was conducted to investigate the effects of wheat straw ammonisation and supplementation with a rumen undegradable protein (UDP) source on nutrient digestion and nitrogen balance by lambs while diets were supplemented with kibbled carob pods as energy source. Ammonisation increased the crude protein content of wheat straw by nearly 100% and decreased the contents of neutral detergent fibre and acid detergent fibre by 7% and 1.7% respectively. Treating the straw with ammonia resulted in significant (P<0.01) increase in nitrogen (N) intake and intakes of organic matter (OM) and dry matter (DM) tended toward significance (P<0.1). The UDP source had no effect (P>0.05) on DM and OM intakes but resulted in an increase (P<0.05) of N intakes. Both, ammonization and UDP supplementation increased (P<0.01) the DM, OM and N digestibility. In conclusion, the results of this study suggest that ammonisation and UDP supplementation is a practical dietary manipulation option to improve the nutritional status of ruminants fed on roughage-based diets.
Effects of abomasal vegetable oil infusion on splanchnic nutrient metabolism in lactating dairy cows
Resumo:
In the present paper, we studied the preparation of biomimetic triblock copolymer (ABA) membranes in aqueous solution and their deposition into solid supports. The self-assembly structures of the ABA in aqueous solution was investigated by using optical microscopy, dynamic light scattering, electron microscopy (EM) and SAXS. Spherical and tubular polymersomes were found at the highest concentrations investigated. The mechanism of deposition on solid supports (mica and glass) was elucidated by using atomic force microscopy (AFM). The deposition results in the formation of a uniform defect-free membrane at suitable polymer concentrations.