Polymorphism of the aryl-hydrocarbon receptor gene in intron 10 of human cancers

Polychlorinated dibenzo-p-dioxins (PCDDs) and related halogenated aromatic hydrocarbons (e.g., PCDFs), often called "dioxins", are ubiquitously present environmental contaminants. Some of them, notably 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), are among the most toxic synthetic compounds known. The biological effects of dioxins are mediated via the aryl hydrocarbon receptor (AhR). Mutations in the AhR transactivation domain are linked to sensitivity to the acute lethality of TCDD. We present here a study of AhR gene polymorphism in normal and cancer human tissues affecting pre-mRNA splicing in the AhR gene-coding transactivation domain region (exon 10, intron 10, exon 11 region), previously shown to be associated with AhR dysfunction. We tested 126 pairs of normal and cancer tissue samples from liver, lung, stomach, kidney, mucous, breast, and pancreas of 49 males and 77 females (45-70 years of age). We used in vitro splicing assay, RT-PCR and sequencing methods. Our results showed that in an in vitro system it is possible to reconstitute cellular pre-mRNA splicing events. Tested cancer tissues did not contain mutations in the AhR transactivation domain region when the DNA sequences were compared with those from normal tissues. There were also no differences in AhR mRNA splice variants between normal and malignant breast tissues and no polymorphisms in the studied regions or cDNA.

BC047440 antisense eukaryotic expression vectors inhibited HepG2 cell proliferation and suppressed xenograft tumorigenicity

The biological functions of the BC047440 gene highly expressed by hepatocellular carcinoma (HCC) are unknown. The objective of this study was to reconstruct antisense eukaryotic expression vectors of the gene for inhibiting HepG2 cell proliferation and suppressing their xenograft tumorigenicity. The full-length BC047440 cDNA was cloned from human primary HCC by RT-PCR. BC047440 gene fragments were ligated with pMD18-T simple vectors and subsequent pcDNA3.1(+) plasmids to construct the recombinant antisense eukaryotic vector pcDNA3.1(+)BC047440AS. The endogenous BC047440 mRNA abundance in target gene-transfected, vector-transfected and naive HepG2 cells was semiquantitatively analyzed by RT-PCR and cell proliferation was measured by the MTT assay. Cell cycle distribution and apoptosis were profiled by flow cytometry. The in vivo xenograft experiment was performed on nude mice to examine the effects of antisense vector on tumorigenicity. BC047440 cDNA fragments were reversely inserted into pcDNA3.1(+) plasmids. The antisense vector significantly reduced the endogenous BC047440 mRNA abundance by 41% in HepG2 cells and inhibited their proliferation in vitro (P < 0.01). More cells were arrested by the antisense vector at the G1 phase in an apoptosis-independent manner (P = 0.014). Additionally, transfection with pcDNA3.1(+)BC047440AS significantly reduced the xenograft tumorigenicity in nude mice. As a novel cell cycle regulator associated with HCC, the BC047440 gene was involved in cell proliferation in vitro and xenograft tumorigenicity in vivo through apoptosis-independent mechanisms.

Cloning, bioinformatics analysis, and expression of the dust mite allergen Der f 5 of Dermatophagoides farinae

Crude extracts of house dust mites are used clinically for diagnosis and immunotherapy of allergic diseases, including bronchial asthma, perennial rhinitis, and atopic dermatitis. However, crude extracts are complexes with non-allergenic antigens and lack effective concentrations of important allergens, resulting in several side effects. Dermatophagoides farinae (Hughes; Acari: Pyroglyphidae) is one of the predominant sources of dust mite allergens, which has more than 30 groups of allergen. The cDNA coding for the group 5 allergen of D. farinae from China was cloned, sequenced and expressed. According to alignment using the VECTOR NTI 9.0 software, there were eight mismatched nucleotides in five cDNA clones resulting in seven incompatible amino acid residues, suggesting that the Der f 5 allergen might have sequence polymorphism. Bioinformatics analysis revealed that the matured Der f 5 allergen has a molecular mass of 13604.03 Da, a theoretical pI of 5.43 and is probably hydrophobic and cytoplasmic. Similarities in amino acid sequences between Der f 5 and allergens of other domestic mite species, viz. Der p 5, Blo t 5, Sui m 5, and Lep d 5, were 79, 48, 53, and 37%, respectively. Phylogenetic analysis indicated that Der f 5 and Der p 5 clustered together. Blo t 5 and Ale o 5 also clustered together, although Blomia tropicalis and Aleuroglyphus ovatus belong to different mite families, viz. Echimyopodidae and Acaridae, respectively.

Whole transcriptome organisation in the dehydrated supraoptic nucleus

The supraoptic nucleus (SON) is part of the central osmotic circuitry that synthesises the hormone vasopressin (Avp) and transports it to terminals in the posterior lobe of the pituitary. Following osmotic stress such as dehydration, this tissue undergoes morphological, electrical and transcriptional changes to facilitate the appropriate regulation and release of Avp into the circulation where it conserves water at the level of the kidney. Here, the organisation of the whole transcriptome following dehydration is modelled to fit Zipf's law, a natural power law that holds true for all natural languages, that states if the frequency of word usage is plotted against its rank, then the log linear regression of this is -1. We have applied this model to our previously published euhydrated and dehydrated SON data to observe this trend and how it changes following dehydration. In accordance with other studies, our whole transcriptome data fit well with this model in the euhydrated SON microarrays, but interestingly, fit better in the dehydrated arrays. This trend was observed in a subset of differentially regulated genes and also following network reconstruction using a third-party database that mines public data. We make use of language as a metaphor that helps us philosophise about the role of the whole transcriptome in providing a suitable environment for the delivery of Avp following a survival threat like dehydration.

Myocardial ischemic preconditioning upregulated protein 1(Mipu1):zinc finger protein 667 - a multifunctional KRAB/C2H2 zinc finger protein

Myocardial ischemic preconditioning upregulated protein 1 (Mipu1) is a newly discovered upregulated gene produced in rats during the myocardial ischemic preconditioning process. Mipu1 cDNA contains a 1824-base pair open reading frame and encodes a 608 amino acid protein with an N-terminal Krüppel-associated box (KRAB) domain and classical zinc finger C2H2 motifs in the C-terminus. Mipu1 protein is located in the cell nucleus. Recent studies found that Mipu1 has a protective effect on the ischemia-reperfusion injury of heart, brain, and other organs. As a nuclear factor, Mipu1 may perform its protective function through directly transcribing and repressing the expression of proapoptotic genes to repress cell apoptosis. In addition, Mipu1 also plays an important role in regulating the gene expression of downstream inflammatory mediators by inhibiting the activation of activator protein-1 and serum response element.

The consensus sequence of FAMLF alternative splice variants is overexpressed in undifferentiated hematopoietic cells

The familial acute myeloid leukemia related factor gene (FAMLF) was previously identified from a familial AML subtractive cDNA library and shown to undergo alternative splicing. This study used real-time quantitative PCR to investigate the expression of the FAMLF alternative-splicing transcript consensus sequence (FAMLF-CS) in peripheral blood mononuclear cells (PBMCs) from 119 patients with de novo acute leukemia (AL) and 104 healthy controls, as well as in CD34+cells from 12 AL patients and 10 healthy donors. A 429-bp fragment from a novel splicing variant of FAMLF was obtained, and a 363-bp consensus sequence was targeted to quantify total FAMLF expression. Kruskal-Wallis, Nemenyi, Spearman's correlation, and Mann-Whitney U-tests were used to analyze the data. FAMLF-CS expression in PBMCs from AL patients and CD34+ cells from AL patients and controls was significantly higher than in control PBMCs (P<0.0001). Moreover,FAMLF-CS expression in PBMCs from the AML group was positively correlated with red blood cell count (rs=0.317, P=0.006), hemoglobin levels (rs=0.210, P=0.049), and percentage of peripheral blood blasts (rs=0.256, P=0.027), but inversely correlated with hemoglobin levels in the control group (rs=–0.391, P<0.0001). AML patients with high CD34+ expression showed significantly higherFAMLF-CS expression than those with low CD34+ expression (P=0.041). Our results showed thatFAMLF is highly expressed in both normal and malignant immature hematopoietic cells, but that expression is lower in normal mature PBMCs.

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de "random primers". A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Partial characterization of genes from the embryonic axis of Melanoxylon brauna Schott. (Leguminosae-Caesalpinioideae) seeds

The objective of this study was to partially characterize some genes involved in the desiccation tolerance of the embryonic axis of Melanoxylon brauna seeds subjected, or not, to oven fast-drying. Seeds were initially dried rapidly in an oven at 40 ºC, 50 ºC, 60 ºC, 70 ºC, and 80 °C, for 24, 48 and 72 h and then subjected to germination tests and moisture content determination. Degenerate primers were designed for 19 genes. The CDNA was used as a template for PCR amplifications using the degenerate primers, and the PCR products obtained were purified, cloned and sequenced. The seeds showed a gradual reduction in percent germination with increasing temperature and drying time. Nucleotide sequences of the cloned fragments related to genes CAT1, SPS1, Abi5, Transk and PM25 were obtained. The similarity analysis with the sequences deposited in databases revealed similarities with genes CAT1, SPS1, Transk and PM25 from other plant species. The nucleotide sequences obtained from the respective genes will be used for designing specific primers for gene expression analyses during seed germination in order to understand the causes for loss of physiological quality of Melanoxylon brauna seeds.

Molecular patterns behind immunological and metabolic alterations in lysinuric protein intolerance

Lysinuric protein intolerance (LPI) is a recessively inherited disorder characterised by reduced plasma and increased urinary levels of cationic amino acids (CAAs), protein malnutrition, growth failure and hyperlipidemia. Some patients develop severe immunological, renal and pulmonary complications. All Finnish patients share the same LPIFin mutation in the SLC7A7 gene that encodes CAA transporter y+LAT1. The aim of this study was to examine molecular factors contributing to the various symptoms, systemic metabolic and lipid profiles, and innate immune responses in LPI. The transcriptomes, metabolomes and lipidomes were analysed in whole-blood cells and plasma using RNA microarrays and gas or liquid chromatography-mass spectrometry techniques, respectively. Toll-like receptor (TLR) signalling in monocyte-derived macrophages exposed to pathogens was scrutinised using qRT-PCR and the Luminex technology. Altered levels of transcripts participating in amino acid transport, immune responses, apoptosis and pathways of hepatic and renal metabolism were identified in the LPI whole-blood cells. The patients had increased non-essential amino acid, triacylglycerol and fatty acid levels, and decreased plasma levels of phosphatidylcholines and practically all essential amino acids. In addition, elevated plasma levels of eight metabolites, long-chain triacylglycerols, two chemoattractant chemokines and nitric oxide correlated with the reduced glomerular function in the patients with kidney disease. Accordingly, it can be hypothesised that the patients have increased autophagy, inflammation, oxidative stress and apoptosis, leading to hepatic steatosis, uremic toxicity and altered intestinal microbe metabolism. Furthermore, the LPI macrophages showed disruption in the TLR2/1, TLR4 and TLR9 pathways, suggesting innate immune dysfunctions with an excessive response to bacterial infections but a deficient viral DNA response.

The osmoadaptive response of the wine yeast Saccharomyces cerevisiae K1-V1116 during icewine fermentation

The adapted metabolic response of commercial wine yeast under prolonged exposure to concentrated solutes present in Icewine juice is not fully understood. Presently, there is no information regarding the transcriptomic changes in gene expression associated with the adaptive stress response ofwine yeast during Icewine fermentation compared to table wine fermentation. To understand how and why wine yeast respond differently at the genomic level and ultimately at the metabolic level during Icewine fermentation, the focus ofthis project was to identify and compare these differences in the wine yeast Saccharomyces cerevisiae KI-Vll16 using cDNA microarray technology during the first five days of fermentation. Significant differences in yeast gene expression patterns between fermentation conditions were correlated to differences in nutrient utilization and metabolite production. Sugar consumption, nitrogen usage and metabolite levels were measured using enzyme assays and HPLC. Also, a small subset of differentially expressed genes was verified using Northern analysis. The high osmotic stress experienced by wine yeast throughout Icewine fermentation elicited changes in cell growth and metabolism correlating to several fermentation difficulties, including reduced biomass accumulation and fermentation rate. Genes associated with carbohydrate and nitrogen transport and metabolism were expressed at lower levels in Icewine juice fermenting cells compared to dilute juice fermenting cells. Osmotic stress, not nutrient availability during Icewine fermentation appears to impede sugar and nitrogen utilization. Previous studies have established that glycerol and acetic acid production are increased in yeast during Icewine fermentation. A gene encoding for a glycerollW symporter (STL1) was found to be highly expressed up to 25-fold in the i Icewine juice condition using microarray and Northern analysis. Active glycerol transport by yeast under hyperosmotic conditions to increase cytosolic glycerol concentration may contribute to reduced cell growth observed in the Icewine juice condition. Additionally, genes encoding for two acetyl CoA synthetase isoforms (ACSl and ACS2) were found to be highly expressed, 19- and II-fold respectively, in dilute juice fermenting cells relative to the Icewine juice condition. Therefore, decreased conversion of acetate to acetyl-CoA may contribute to increased acetic acid production during Icewine fermentation. These results further help to explain the response of wine yeast as they adapt to Icewine juice fermentation. ii

Isolation of DNA sequences with homology to a degenerate FaRP oligonucleotide from the crayfish Procambarus clarkii

The neuropeptide Th1RFamide with the sequence Phe-Met-Arg-Phe-amide was originally isolated in the clam Macrocallista nimbosa (price and Greenberg, 1977). Since its discovery, a large family ofFl\1RFamide-related peptides termed FaRPs have been found to be present in all major animal phyla with functions ranging from modulation of neuronal activity to alteration of muscular contractions. However, little is known about the genetics encoding these peptides, especially in invertebrates. As FaRP-encoding genes have yet to be investigated in the invertebrate Malacostracean subphylum, the isolation and characterization ofFaRP-encoding DNA and mRNA was pursued in this project. The immediate aims of this thesis were: (1) to amplify mRNA sequences of Procambarus clarkii using a degenerate oligonucleotide primer deduced from the common amino acid sequence ofisolated Procambarus FaRPS, (2) to determine if these amplification products encode FaRP gene sequences, and (3) to create a selective cDNA library of sequences recognized by the degenerate oligonucleotide primer. The polymerase chain reaction - rapid amplification of cDNA ends (PCR-RACE) is a procedure in which a single gene-specific primer is used in conjunction with a generalized 3' or 5' primer to amplify copies ofthe region between a single point in the transcript and the 3' or 5' end of cDNA of interest (Frohman et aI., 1988). PCRRACE reactions were optimized with respect to primers used, buffer composition, cycle number, nature ofgenetic substrate to be amplified, annealing, extension and denaturation temperatures and times, and use of reamplification procedures. Amplification products were cloned into plasmid vectors and recombinant products were isolated, as were the recombinant plaques formed in the selective cDNA library. Labeled amplification products were hybridized to recombinant bacteriophage to determine ligated amplification product presence. When sequenced, the five isolated PCR-RACE amplification products were determined not to possess FaRP-encoding sequences. The 200bp, 450bp, and 1500bp sequences showed homology to the Caenorhabditis elegans cosmid K09A11, which encodes for cytochrome P450; transfer-RNA; transposase; and tRNA-Tyr, while the 500bp and 750bp sequences showed homology with the complete genome of the Vaccinia virus. Under the employed amplification conditions the degenerate oligonucleotide primer was observed to bind to and to amplify sequences with either 9 or 10bp of 17bp identity. The selective cDNA library was obselVed to be of extremely low titre. When library titre was increased, white. plaques were isolated. Amplification analysis of eight isolated Agt11 sequences from these plaques indicated an absence of an insertion sequence. The degenerate 17 base oligonucleotide primer synthesized from the common amino acid sequence ofisolated Procambarus FaRPs was thus determined to be non-specific in its binding under the conditions required for its use, and to be insufficient for the isolation and identification ofFaRP-encoding sequences. A more specific primer oflonger sequence, lower degeneracy, and higher melting temperature (TJ is recommended for further investigation into the FaRP-encoding genes of Procambarlls clarkii.

Identification of novel retinoid receptors and their roles in vertebrate and invertebrate nervous systems

In vertebrates, signaling by retinoic acid (RA) is known to play an important role in embryonic development, as well as organ homeostasis in the adult. In organisms such as adult axolotls and newts, RA is also important for regeneration of the CNS, limb, tail, and many other organ systems. RA mediates many of its effects in development and regeneration through nuclear receptors, known as retinoic acid receptors (RARs) and retinoid X receptors (RXRs). This study provides evidence for an important role of the RA receptor, RAR~2, in ,( '. regeneration ofthe spinal cord and tail of the adult newt. It has previously been proposed that the ability of the nervous system to regenerate might depend on the presence or absence of this RAR~2 isoform. Here, I show for the very first time, that the regenerating spinal cord of the adult newt expresses this ~2 receptor isoform, and inhibition of retinoid signaling through this specific receptor with a selective antagonist inhibits tail and spinal cord regeneration. This provides the first evidence for a role of this receptor in this process. Another species capable of CNS ~~generation in the adult is the invertebrate, " Lymnaea stagnalis. Although RA has been detected in a small number of invertebrates (including Lymnaea), the existence and functional roles of the retinoid receptors in most invertebrate non-chordates, have not been previously studied. It has been widely believed, however, that invertebrate non-chordates only possess the RXR class of retinoid receptors, but not the RARs. In this study, a full-length RXR cDNA has been cloned, which was the first retinoid receptor to be discovered in Lymnaea. I then went on to clone the very first full-length RAR eDNA from any non-chordate, invertebrate species. The functional role of these receptors was examined, and it was shown that normal molluscan development was altered, to varying degrees, by the presence of various RXR and RAR agonists or antagonists. The resulting disruptions in embryogenesis ranged from eye and shell defects, to complete lysis of the early embryo. These studies strongly suggest an important role for both the RXR and RAR in non-chordate development. The molluscan RXR and RAR were also shown to be expressed in the adult, nonregenerating eNS, as well as in individual motor neurons regenerating in culture. More specifically, their expression displayed a non-nuclear distfibution, suggesting a possible non-genomic role for these 'nuclear' receptors. It was shown that immunoreactivity for the RXR was present in almost all regenerating growth cones, and (together with N. Farrar) it was shown that this RXR played a novel, non-genomic role in mediating growth cone turning toward retinoic acid. Immunoreactivity for the novel invertebrate RAR was also found in the regenerating growth cones, but future work will be required to determine its functional role in nerve cell regeneration. Taken together, these data provide evidence for the importance of these novel '. retinoid receptors in development and regeneration, particularly in the adult nervous system, and the conservation of their effects in mediating RA signaling from invertebrates to vertebrates.

Caractérisation de la SERPINA1, une antiprotéase différentiellement exprimée dans le cancer épithélial de l’ovaire

Le cancer épithélial de l’ovaire est le cancer gynécologique le plus létal. La survie à 5 ans est de 30-40% chez les patientes atteintes d’une tumeur invasive (TOV), comparativement à 95% chez les patientes diagnostiquées pour une tumeur à faible potentiel de malignité ou borderline (LMP). Au laboratoire, l’analyse de l’expression des gènes de la micropuce à ADN U133 d’Affymetrix a révélé que la SERPINA1 est un gène dont l’expression varie entre les tumeurs LMP et TOV. La validation par Q-PCR nous a confirmé que cette antiprotéase est majoritairement surexprimée dans les tumeurs LMP, par rapport aux tumeurs bénignes (BOV) et aux tumeurs TOV. Nous avons donc surexprimé la SERPINA1 dans les lignées cellulaires invasives TOV 112D et TOV 1946 du cancer de l’ovaire et dérivé des clones stables. Les résultats obtenus nous indiquent que la surexpression de la SERPINA1 a un effet sur la capacité d’invasion et de migration cellulaire et non au niveau de la croissance cellulaire et la formation de structures tridimensionnelles. Les résultats issus de l’étude in vivo dans les souris SCID nous permettront de déterminer si la surexpression de la SERPINA1 a un effet sur la tumorigénèse ovarienne. Ainsi, la SERPINA1 demeure à notre avis un candidat d’intérêt pour tenter de mieux comprendre les différences biologiques entre les tumeurs LMP et TOV, ainsi que le rôle des protéases et de leurs inhibiteurs dans la progression tumorale du cancer de l’ovaire.

Étude du rôle des gènes TGF-β1 et HSP-70 lors du processus de régénération du membre chez l’axolotl

Les urodèles amphibiens, dont fait partie l’axolotl (Ambystoma mexicanum), ont la capacité de régénérer leurs organes et membres suite à une amputation, tout au long de leur vie. La patte est l’organe dont le processus de régénération est le mieux caractérisé et ce dernier est divisé en deux phases principales. La première est la phase de préparation et commence immédiatement suite à l’amputation. Elle renferme des étapes essentielles au processus de régénération comme la guérison de la plaie et la formation d’une coiffe apicale ectodermique. Par la suite, les fibroblastes du derme et certaines cellules musculaires vont revenir à un état pluripotent via un processus appelé dédifférenciation cellulaire. Une fois dédifférenciées, ces cellules migrent et s’accumulent sous la coiffe apicale pour former le blastème. Lors de la phase de redéveloppement, les cellules du blastème se divisent puis se redifférencient pour régénérer la partie amputée. Fait intéressant, la régénération d’un membre ou la guérison d’une plaie chez l’axolotl ne mène jamais à la formation d’une cicatrice. Afin d’en apprendre plus sur le contrôle moléculaire de la régénération, les gènes Heat-shock protein-70 (Hsp-70) et Transforming growth factor-β1 (Tgf-β1) ont été sélectionnés. Ces gènes jouent un rôle important dans la réponse au stress et lors de la guérison des plaies chez les mammifères. HSP-70 est une chaperonne moléculaire qui est produite pour maintenir l’intégrité des protéines cellulaires lorsqu’un stress se présente. TGF-β1 est une cytokine produite suite à une blessure qui active la réponse inflammatoire et qui stimule la fermeture de la plaie chez les amniotes. Les résultats présentés dans cette thèse démontrent que Hsp-70 est exprimé et régulé lors du développement et de la régénération du membre chez l’axolotl. D’autre part, nos expériences ont mené à l’isolation de la séquence codante pour Tgf-β1 chez l’axolotl. Nos résultats montrent que Tgf-β1 est exprimé spécifiquement lors de la phase de préparation dans le membre en régénération. De plus, le blocage de la voie des Tgf-β avec l’inhibiteur pharmacologique SB-431542, lors de la régénération, mène à l’inhibition du processus. Ceci démontre que la signalisation via la voie des Tgf-β est essentielle à la régénération du membre chez l’axolotl.

Étude de l’activité de Staufen1 dans la régulation traductionnelle de certains ARNm

Le transport et la traduction localisée des ARN messagers sont observés chez plusieurs organismes et sont requis pour de multiples phénomènes tels la mémoire, la division cellulaire asymétrique et l’établissement des axes durant le développement. Staufen, une protéine liant l’ARN double-brin, a été identifié dans un premier temps chez la mouche à fruits Drosophila melanogaster. Il a été montré, chez cet organisme, que Staufen est requis pour la localisation des messagers bicoid et oskar aux pôles antérieur et postérieur de l’ovocyte, respectivement. Également, Staufen est requis afin que la répression traductionnelle du messager oskar soit levée une fois qu’il est bien localisé. Chez les mammifères, Stau1 est une protéine ubiquiste qui est présente dans des complexes prenant la forme de granules dans les dendrites des neurones. Également, Stau1 peut interagir de façon indépendante de l’ARN avec le ribosome et cofractionner tant avec la sous-unité 40S qu’avec la sous-unité 60S du ribosome dans un gradient de saccharose. L’implication de Stau1 dans un mécanisme permettant la dérépression traductionnelle de certains ARNm chez les mammifères était donc une voie d’investigation intéressante. Nous avons donc décidé de vérifier si Stau1 mammifère avait la capacité de stimuler la traduction d’un ARNm cellulaire via un mécanisme régulé. Au moment où cette thèse a été entreprise, aucun ARNm cellulaire lié par Stau1 n’avait été identifié chez les mammifères. Des structures d’ARN double-brin ont donc été employées afin de réprimer la traduction d’un ARNm rapporteur. C’est ainsi que nous avons montré que Stau1 peut stimuler la traduction d’un ARNm lorsqu’il lie celui-ci dans sa région 5’ non-traduite. Par la suite, en employant des micropuces d’ADN, nous avons identifié des messagers cellulaires dont la distribution dans les polysomes lourds est modifiée par Stau1. En effet, un groupe de messagers est enrichi dans les polysomes lourds suite à une surexpression de Stau1, ce qui suggère que Stau1 stimule la traduction de cette population d’ARNm. Afin d’identifier un mécanisme potentiel de régulation de l’activité traductionnelle de Stau1, nous nous sommes intéressés à la capacité d’auto-association de cette protéine. Nous avons montré que Stau1, tout comme plusieurs protéines liant l’ARN double-brin, est en mesure de s’associer à lui-même, et ce, d’une façon indépendante de l’ARN. Nous avons identifié les déterminants impliqués mettant ainsi au jour un nouveau mécanisme pouvant influencer les activités cellulaires de Stau1. Les résultats présentés dans cette thèse suggèrent donc que Stau1 est en mesure de stimuler la traduction d’une sous-population précise d’ARN messagers au sein de la cellule permettant ainsi de jeter un regard nouveau sur l’implication de cette protéine dans divers phénomènes au sein de l’organisme.