927 resultados para SimplexaTM Dengue real-time RT-PCR
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
Lettuce mottle virus (LeMoV) and dandelion yellow mosaic virus (DaYMV) infect lettuce in South America and Europe, respectively. LeMoV and DaYMV possess isometric particles, occur at low concentrations in plants and have narrow host ranges. Partial genome sequences of both viruses were obtained using purified viral preparations and universal primers for members of the family Sequiviridae. DaYMV and LeMoV sequences were analyzed and showed identity with other members of the family. Universal primers that detect both viruses and specific primers for LeMoV and DaYMV were designed and used in RT-PCR-based diagnostic assays. These results provide the first molecular data on the LeMoV and DaYMV genomes and suggest that LeMoV is a member of the genus Sequivirus, probably distinct from DaYMV.
Resumo:
Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Induction motors are largely used in several industry sectors. The selection of an induction motor has still been inaccurate because in most of the cases the load behavior in its shaft is completely unknown. The proposal of this article is to use artificial neural networks for torque estimation with the purpose of best selecting the induction motors rather than conventional methods, which use classical identification techniques and mechanical load modeling. Since proposed approach estimates the torque behavior from the transient to the steady state, one of its main contributions is the potential to also be implemented in control schemes for real-time applications. Simulation results are also presented to validate the proposed approach.
Resumo:
Condition monitoring is used to increase machinery availability and machinery performance, reducing consequential damage, increasing machine life, reducing spare parts inventories, and reducing breakdown maintenance. An efficient real time vibration measurement and analysis instruments is capable of providing warning and predicting faults at early stages. In this paper, a new methodology for the implementation of vibration measurement and analysis instruments in real time based on circuit architecture mapped from a MATLAB/Simulink model is presented. In this study, signal processing applications such as FIR filters and fast Fourier transform are treated as systems, which are implemented in hardware using a system generator toolbox, which translates a Simulink model in a hardware description language - HDL for FPGA implementations.
A new method for real time computation of power quality indices based on instantaneous space phasors
Resumo:
One of the important issues about using renewable energy is the integration of dispersed generation in the distribution networks. Previous experience has shown that the integration of dispersed generation can improve voltage profile in the network, decrease loss, etc. but can create safety and technical problems as well. This work report the application of the instantaneous space phasors and the instantaneous complex power in observing performances of the distribution networks with dispersed generators in steady state. New IEEE apparent power definition, the so-called Buchholz-Goodhue effective apparent power, as well as new proposed power quality (oscillation) index in the three-phase distribution systems with unbalanced loads and dispersed generators, are applied. Results obtained from several case studies using IEEE 34 nodes test network are presented and discussed. (C) 2006 Elsevier B.V. All rights reserved.
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
The aim of the present trial was to evaluate the heminested RT-PCR for the study of rabies virus distribution in mice inoculated experimentally. Inoculation was by the intramuscular route in 150 mice, using the dog street rabies virus. Groups of five animals were killed at different times. Fragments of different organs were collected and the material was tested by Fluorescent Antibody Test (FAT) and heminested RT-PCR (hn RT-PCR). Positive results were obtained beginning on the 10th day after inoculation in the brain, spinal cord, salivary gland, limbs, lungs, liver, spleen, urinary bladder, tongue and right kidney. Hn RT-PCR was shown to be more efficient for the study of rabies virus distribution in different tissues and organs. (C) 2004 Elsevier B.V.. All rights reserved.
Resumo:
Real-time ultrasonography (RTU) was used to measure the longissimus dorsi muscle (LM) volume in vivo and to predict the carcass composition of rabbits. For this, 63 New Zealand White × Californian rabbits with 2093±63 g live weight were used. Animals were scanned between the 6th and 7th lumbar vertebrae using an RTU equipment with a 7.5 MHz probe. Measurements of LM volume were obtianed both in vivo and on carcass. Regression equations were used for the prediction of carcass composition and LM volume using the LM volume measured obtained with RTU (LMVU) as independent variable. Carcass meat, bone and total dissectible fat weights represented 780, 164 and 56 g/kg of the reference carcass weight, respectively. Regression equations showed a strong relationship between LMVU and the correspondent volume in carcass. Furthermore, LMVU was also useful in predicting the amounts of carcass tissues. It is possible to predict LM volume in the carcass using the LM volume measured in vivo by RTU. The amount of carcass tissues can be predicted by the LM volume measured in vivo by RTU.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
This paper describes an electronic device conceived to convert common web texts into sequences of corresponding Braille signals, which are immediately reproduced onto an array ( keyboard) of electromechanical actuators. These actuators are reconfigurable in real time, displaying the Braille characters as matrices of points composed by small stems which can be lowered or raised according to the Braille code. The device, together with its conversion software package, can provide direct access to web texts in any personal computer, thus avoiding the use of complicated Braille printers.
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
Quartz Crystal Microbalance (QCM) was used to monitor the mass changes on a quartz crystal surface containing immobilized lectins that interacted with carbohydrates. The strategy for lectin immobilization was developed on the basis of a multilayer system composed of Au-cystamine-glutaraldehyde-lectin. Each step of the immobilization procedure was confirmed by FTIR analysis. The system was used to study the interactions of Concanavalin A (ConA) with maltose and Jacalin with Fetuin. The real-time binding of different concentrations of carbohydrate to the immobilized lectin was monitored by means of QCM measurements and the data obtained allowed for the construction of Langmuir isotherm curves. The association constants determined for the specific interactions analyzed here were (6.4 +/- 0.2) X 10(4) M-1 for Jacalin-Fetuin and (4.5 +/- 0.1) x 10(2) M-1 for ConA-maltose. These results indicate that the QCM constitutes a suitable method for the analysis of lectin-carbohydrate interactions, even when assaying low molecular mass ligands such as disaccharides. Published by Elsevier B.V.