868 resultados para Regulatory reforms


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Malaria poses a significant public health problem worldwide. The World Health Organization indicates that approximately 40% of the world's population and almost 85% of the population from the South–East Asian region is at risk of contracting malaria. India being the most populous country in the region, contributes the highest number of malaria cases and deaths attributed to malaria. Orissa is the state that has the highest number of malaria cases and deaths attributable to malaria. A secondary data analysis was carried out to evaluate the effectiveness of the World bank-assisted Malaria Action Program in the state of Orissa under the health sector reforms of 1995-96. The secondary analysis utilized the government of India's National Anti Malaria Management Information System's (NAMMIS) surveillance data and the National Family Health Survey (NFHS–I and NFHS–II) datasets to compare the malaria mortality and morbidity in the state between 1992-93 and 1998-99. Results revealed no effect of the intervention and indicated an increase of 2.18 times in malaria mortality between 1992-1999 and an increase of 1.53 times in malaria morbidity between 1992-93 and 1998-99 in the state. The difference in the age-adjusted malaria morbidity in the state between the time periods of 1992-93 and 1998-99 proved to be highly significant (t = 4.29 df=16, p<. 0005) whereas the difference between the increase of age-adjusted malaria morbidity during 1992-93 and 1998-99 between Orissa (with intervention) and Bihar (no intervention) proved to be non significant (t=.0471 df=16, p<.50). Factors such as underutilization of World Bank funds for the malaria control program, inadequate health care infrastructure, structural adjustment problems, poor management, poor financial management, parasite resistance to anti-malarial drugs, inadequate supply of drugs and staff shortages may have contributed to the failure of the program in the state.^

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Chromatin, composed of repeating nucleosome units, is the genetic polymer of life. To aid in DNA compaction and organized storage, the double helix wraps around a core complex of histone proteins to form the nucleosome, and is therefore no longer freely accessible to cellular proteins for the processes of transcription, replication and DNA repair. Over the course of evolution, DNA-based applications have developed routes to access DNA bound up in chromatin, and further, have actually utilized the chromatin structure to create another level of complexity and information storage. The histone molecules that DNA surrounds have free-floating tails that extend out of the nucleosome. These tails are post-translationally modified to create docking sites for the proteins involved in transcription, replication and repair, thus providing one prominent way that specific genomic sequences are accessed and manipulated. Adding another degree of information storage, histone tail-modifications paint the genome in precise manners to influence a state of transcriptional activity or repression, to generate euchromatin, containing gene-dense regions, or heterochromatin, containing repeat sequences and low-density gene regions. The work presented here is the study of histone tail modifications, how they are written and how they are read, divided into two projects. Both begin with protein microarray experiments where we discover the protein domains that can bind modified histone tails, and how multiple tail modifications can influence this binding. Project one then looks deeper into the enzymes that lay down the tail modifications. Specifically, we studied histone-tail arginine methylation by PRMT6. We found that methylation of a specific histone residue by PRMT6, arginine 2 of H3, can antagonize the binding of protein domains to the H3 tail and therefore affect transcription of genes regulated by the H3-tail binding proteins. Project two focuses on a protein we identified to bind modified histone tails, PHF20, and was an endeavor to discover the biological role of this protein. Thus, in total, we are looking at a complete process: (1) histone tail modification by an enzyme (here, PRMT6), (2) how this and other modifications are bound by conserved protein domains, and (3) by using PHF20 as an example, the functional outcome of binding through investigating the biological role of a chromatin reader. ^

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Transcription of the Bacillus anthracis structural genes for the anthrax toxin proteins and biosynthetic operon for capsule are positively regulated by AtxA, a transcription regulator with unique properties. Consistent with the role of atxA in virulence factor expression, a B. anthracis atxA-null mutant is avirulent in a murine model for anthrax. In batch culture, multiple signals impact atxA transcript levels, and the timing and steady state level of atxA expression is critical for optimal toxin and capsule synthesis. Despite the apparent complex control of atxA transcription, only one trans-acting protein, the transition state regulator AbrB, has been demonstrated to directly interact with the atxA promoter. The AbrB-binding site has been described, but additional cis-acting control sequences have not been defined. Using transcriptional lacZ fusions, electrophoretic mobility shift assays, and Western blot analysis, the cis-acting elements and trans-acting factors involved in regulation of atxA in B. anthracis strains containing either both virulence plasmids, pXO1 and pXO2, or only one plasmid, pXO1, were studied. This work demonstrates that atxA transcription from the major start site P1 is dependent upon a consensus sequence for the housekeeping sigma factor SigA, and an A+T-rich upstream element (UP-element) for RNA polymerase (RNAP). In addition, the data show that a trans-acting protein(s) other than AbrB negatively impacts atxA transcription when it binds specifically to a 9-bp palindrome within atxA promoter sequences located downstream of P1. Mutation of the palindrome prevents binding of the trans-acting protein(s) and results in a corresponding increase in AtxA and anthrax toxin production in a strain- and culture-dependent manner. The identity of the trans-acting repressor protein(s) remains elusive; however, phenotypes associated with mutation of the repressor binding site have revealed that the trans-acting repressor protein(s) indirectly controls B. anthracis development. Mutation of the repressor binding site results in misregulation and overexpression of AtxA in conditions conducive for development, leading to a marked sporulation defect that is both atxA- and pXO2-61-dependent. pXO2-61 is homologous to the sensor domain of sporulation sensor histidine kinases and is proposed to titrate an activating signal away from the sporulation phosphorelay when overexpressed by AtxA. These results indicate that AtxA is not only a master virulence regulator, but also a modulator of proper B. anthracis development. Also demonstrated in this work is the impact of the developmental regulators AbrB, Spo0A, and SigH on atxA expression and anthrax toxin production in a genetically incomplete (pXO1+, pXO2-) and genetically complete (pXO1+, pXO2+) strain background. AtxA and anthrax toxin production resulting from deletion of the developmental regulators are strain-dependent suggesting that factors on pXO2 are involved in control of atxA. The only developmental deletion mutant that resulted in a prominent and consistent strain-independent increase in AtxA protein levels was an abrB-null mutant. As a result of increased AtxA levels, there is early and increased production of anthrax toxins in an abrB-null mutant. In addition, the abrB-null mutant exhibited an increase in virulence in a murine model for anthrax. In contrast, virulence of the atxA promoter mutant was unaffected in a murine model for anthrax despite the production of 5-fold more AtxA than the abrB-null mutant. These results imply that AtxA is not the only factor impacting pathogenesis in an abrB-null mutant. Overall, this work highlights the complex regulatory network that governs expression of atxA and provides an additional role for AtxA in B. anthracis development.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Cellular oncogenes and tumor suppressor genes regulate cellular adhesion and proliferation, two important events in malignant transformation. Even though receptor-like protein tyrosine phosphatases (R-PTPs) can influence these events, their role in malignant transformation has not been studied. The major goal of this study was to determine whether downregulation of R-PTP$\mu$ expression in lung epithelial cells is associated with or causal to neoplastic transformation. Examination of R-PTP$\mu$ expression in normal and carcinoma cells demonstrated that lung epithelial cells expressed R-PTP$\mu$ whereas lung carcinoma cells did not, and that incubation with TGF-$\alpha$ and HGF induced a two fold increase in R-PTP$\mu$ mRNA expression. To associate the expression of R-PTP$\mu$ with neoplastic transformation, we transfected lung epithelial cells with the H-ras oncogene. Transformation resulted in the activation of the MAPK signal transduction pathway, the hyperphosphorylation of c-met, and the production of HGF. Upon analysis of R-PTP$\mu$ expression, we observed a significant decrease in R-PTP$\mu$ mRNA and protein levels suggesting that transformation can directly or indirectly downregulate the expression of R-PTP$\mu.$ TGF-$\beta$ reversed the H-ras transformed phenotype, an event directly correlated with upregulation of R-PTP$\mu.$ To provide a casual relationship between R-PTP$\mu$ and cessation of tumor cell growth, we transfected carcinoma cells with the wild type R-PTP$\mu$ cDNA. Transiently expressing cells were selected by FACS using the mAb 3D7 and plated into individual wells. Carcinoma cells positive for R-PTP$\mu$ expression did not grow into colonies whereas non-R-PTP$\mu$ expressing carcinoma cells did, suggesting that expression of R-PTP$\mu$ arrested cell growth. To better understand the growth arrest induced by R-PTP$\mu$, we transfected the H-ras transformed lung epithelial cell line (MvLu-1-ras) with R-PTP$\mu$ (MvLu-1-ras/R-PTP$\mu$). Examination of growth factor receptor phosphorylation revealed significant inhibition of c-met and EGF-R. Furthermore, these cells underwent apoptosis in the absence of serum. Taken together the data demonstrate that the downregulation of R-PTP$\mu$ expression is an important step in neoplastic transformation of lung epithelial cells and that its presence can induce apoptosis and inhibit the signaling of c-met and EGF-R, two major growth factor receptors in lung carcinoma. In conclusion, the expression of R-PTP$\mu$ is inversely correlated with neoplastic transformation, growth and survival of tumor cells. ^

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The creation, preservation, and degeneration of cis-regulatory elements controlling developmental gene expression are fundamental genome-level evolutionary processes about which little is known. In this study, critical differences in cis-regulatory elements controlling the expression of the sea urchin aboral ectoderm-specific spec genes were identified and explored. In genomes of species within the Strongylocentrotidae family, multiple copies of a repetitive sequence element termed RSR were present, but RSRs were not detected in genomes of species outside Strongylocentrotidae. RSRs are invariably associated with spec genes, and in Strongylocentrotus purpuratus, the spec2a RSR functioned as a transcriptional enhancer displaying greater activity than RSRs from the spec1 or spec2c paralogs. Single base-pair differences at two cis-regulatory elements within the spec2a RSR greatly increased the binding affinities of four transcription factors: SpCCAAT-binding factor at one element and SpOtx, SpGoosecoid, and SpGATA-E at another. The cis-regulatory elements to which SpCCAAT-binding factor, SpOtx, SpGoosecoid, and SpGATA-E bound were recent evolutionary acquisitions that could act either to activate or repress transcription, depending on the cell type. These elements were found in the spec2a RSR ortholog in Strongylocentrotus pallidus but not in the RSR orthologs of Strongylocentrotus droebachiensis or Hemicentrotus pulcherrimus. These results indicate that spec genes exhibit a dynamic pattern of cis-regulatory element evolution while stabilizing selection preserves their aboral ectoderm expression domain. ^

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Contiene Informe completo y resumen.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The tissue distribution and ontogeny of Na+/K+-ATPase has been examined as an indicator for ion-regulatory epithelia in whole animal sections of embryos and hatchlings of two cephalopod species: the squid Loligo vulgaris and the cuttlefish Sepia officinalis. This is the first report of the immunohistochemical localization of cephalopod Na+/K+-ATPase with the polyclonal antibody alpha (H-300) raised against the human alpha1-subunit of Na+/K+-ATPase. Na+/K+-ATPase immunoreactivity was observed in several tissues (gills, pancreatic appendages, nerves), exclusively located in baso-lateral membranes lining blood sinuses. Furthermore, large single cells in the gill of adult L. vulgaris specimens closely resembled Na+/K+-ATPase-rich cells described in fish. Immunohistochemical observations indicated that the amount and distribution of Na+/K+-ATPase in late cuttlefish embryos was similar to that found in juvenile and adult stages. The ion-regulatory epithelia (e.g., gills, excretory organs) of the squid embryos and paralarvae exhibited less differentiation than adults. Na+/K+-ATPase activities for whole animals were higher in hatchlings of S. officinalis (157.0 ± 32.4 µmol/g FM/h) than in those of L. vulgaris (31.8 ± 3.3 µmol/g FM/h). S. officinalis gills and pancreatic appendages achieved activities of 94.8 ± 18.5 and 421.8 ± 102.3 µmol ATP/g FM/h, respectively. High concentrations of Na+/K+-ATPase in late cephalopod embryos might be important in coping with the challenging abiotic conditions (low pH, high pCO2) that these organisms encounter inside their eggs. Our results also suggest a higher sensitivity of squid vs. cuttlefish embryos to environmental acid-base disturbances.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

More than one-third of the World Trade Organization-notified services trade agreements that were in effect between January 2008 and August 2015 involved at least one South or Southeast Asian trading partner. Drawing on Baier and Bergstrand’s (2004) determinants of preferential trade agreements and using the World Bank’s database on the restrictiveness of domestic services regimes (Borchert, Gootiiz, and Mattoo 2012), we examine the potential for negotiated regulatory convergence in Asian services markets. Our results suggest that Asian economies with high levels of preexisting bilateral merchandise trade and wide differences in services regulatory frameworks are more likely candidates for services trade agreement formation. Such results lend support to the hypothesis that the heightened “servicification” of production generates demand for the lowered services input costs resulting from negotiated market openings.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

More than a third of the World Trade Organization (WTO)-notified services trade agreements (STAs) in effect over January 2008 - August 2015 have involved at least one (South or Southeast) Asian trading partner. Drawing on Baier and Bergstrand's (2004) determinants of preferential trade agreements and using the World Bank's database on the restrictiveness of domestic services regimes (Borchert et.al. 2012), we examine the potential for negotiated regulatory convergence in Asian services markets. Our results suggest that countries within Asia with high levels of pre-existing bilateral merchandise trade and wide differences in services regulatory frameworks are more likely candidates for STA formation. Such results lend support to the hypothesis that the heightened "servicification" of production generates a demand for the lowered service input costs resulting from negotiated market opening.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This paper reports the results of an analysis of changes in income inequality, and in its determinants, in urban China since the economic reforms that began in 1978. The intention is to identify new characteristics of economic inequality. It first shows that income differentials acrossand in provinces widened and that their economic rankings were becoming fixed during the period from 1988 to 1995. Second, age was the major factor in inequality in 1988, while education became the important factor in 1995. Third, education significantly contributed to increasing inequality during the period. Fourth, the higher education-level groups had less within-group inequality. These changes reflect the penetration of the market mechanism into China after the reforms. However, this will be problematic without equality of opportunity.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Introduction : The source and deployment of finance are central issues in economic development. Since 1966, when the Soeharto Administration was inaugurated, Indonesian economic development has relied on funds in the form of aid from international organizations and foreign countries. After the 1990s, a further abundant inflow of capital sustained a rapid economic development. Foreign funding was the basis of Indonesian economic growth. This paper will describe the mechanism for allocating funds in the Indonesian economy. It will identify the problems this mechanism generated in the Indonesian experience, and it will attempt to explain why there was a collapse of the financial system in the wake of the Asian Currency Crisis of 1997. History of the Indonesian Financial system The year 1966 saw the emergence of commercial banks in Indonesia. It can be said that before 1966 a financial system hardly existed, a fact commonly attributed to economic disruptions like the consecutive runs of fiscal deficit and hyperinflation under the Soekarno Administration. After 1996, with the inauguration of Soeharto, a regulatory system of financial legislation, e.g. central banking law and banking regulation, was introduced and implemented, and the banking sector that is the basis of the current financial system in Indonesia was built up.    The Indonesian financial structure was significantly altered at the first financial reform of 1983. Between 1966 and 1982, the banking sector consisted of Bank Indonesia (the Central Bank) and the state-owned banks. There was also a system for distributing the abundant public revenue derived from the soaring oil price of the 1970s. The public finance distribution function, incorporated in Indonesian financial system, changed after the successive financial reforms of 1983 and 1988, when there was a move away from the monopoly-market style dominated by state-owned banks (which was a system of public finance distribution that operated at the discretion of the government) towards a modern market mechanism. The five phases of development The Indonesian financial system developed in five phases between 1966 and the present time. The first period (1966-72) was its formative period, the second (1973-82) its policy based finance period under soaring oil prices, the third (1983-91) its financial-reform period, the fourth (1992-97) its period of expansion, and the fifth (1998-) its period of financial restructuring. The first section of this paper summarizes the financial policies operative during each of the periods identified above. In the second section changes to the financial sector in response to policies are examined, and an analysis of these changes shows that an important development of the financial sector occurred during the financial reform period. In the third section the focus of analysis shifts from the general financial sector to particular commercial banks’ performances. In the third section changes in commercial banks’ lending and fund-raising behaviour after the 1990s are analysed by comparing several banking groups in terms of their ownership and foundation time. The last section summarizes the foregoing analyses and examines the problems that remain in the Indonesian financial sector, which is still undergoing restructuring.