994 resultados para Posteroanterior motion test
Resumo:
Premature failure of concrete pavement contraction joint seals is an ongoing and costly problem for the Iowa Department of Transportation. Several joint seal test sections consisting of variations in sawing methods, joint cleaning techniques, sealant installation, and sealant types have been established over the past few years. Laboratory analysis and field inspections were done as a part of the tests, and core samples were taken for laboratory adhesion pull tests. Such methods often cover specifically small areas and may not expose hidden failures. Some tests are also labor-intensive and destructive, especially that of coring. An innovative, nondestructive, broad coverage joint seal tester that yields quick results has been designed and developed for evaluation of pavement joint seal performance. The Iowa vacuum joint seal tester (IA-VAC) applies a low vacuum above a joint seal that has been spray-covered with a foaming water solution. Any unsealed area or leak that exists along the joint will become quickly and clearly visible by the development of bubbles at the leak point. By analyzing the results from the IA-VAC tests, information on the number and types of leaks can be obtained; such information will help identify the source of the problem and direct efforts toward a solution.
Resumo:
The Iowa State Highway Commission purchased a Conrad automatic freeze and thaw machine and placed it in operation during October 1961. There were a few problems, but considering, the many electrical and mechanical devices used in the automatic system it has always functioned quite well. Rapid freezing and thawing of 4"x4"xl8" concrete beams has been conducted primarily in accordance with ASTM C-29l (now ASTM C-666 procedure B) at the rate of one beam per day. Over 4000 beams have been tested since 1961, with determination of the resulting durability factors. Various methods of curing were used and a standard 90 day moist cure was selected. This cure seemed to yield durability factors that correlated very well with ratings of coarse aggregates based on service records. Some concrete beams had been made using the same coarse aggregate and the durability factors compared relatively well with previous tests. Durability factors seemed to yield reasonable results until large variations in durability factors were noted from beams of identical concrete mix proportions in research projects R-234 and R-247. This then presents the question "How reliable is the durability as determined by ASTM C-666?" This question became increasingly more important when a specification requiring a minimum durability factor for P.C. concrete made from coarse aggregates was incorporated into the 1972 Standard Specification for coarse aggregates for concrete.
Resumo:
The nose is the anatomical site usually recommended for methicillin-resistant Staphylococcus aureus (MRSA) screening. Other sites are also recommended, but are more controversial. We showed that the sensitivities of MRSA detection from nasal swabs alone were 48% and 62% by culture or by rapid PCR test, respectively. These percentages increased to 79% and 92% with the addition of groin swabs, and to 96% and 99% with the addition of groin and throat swabs. In conclusion, neither by culture nor by rapid PCR test is nose sampling alone sufficient for MRSA detection. Additional anatomical sites should include at least the groin and throat.
Resumo:
Diffusion-weighting in magnetic resonance imaging (MRI) increases the sensitivity to molecular Brownian motion, providing insight in the micro-environment of the underlying tissue types and structures. At the same time, the diffusion weighting renders the scans sensitive to other motion, including bulk patient motion. Typically, several image volumes are needed to extract diffusion information, inducing also inter-volume motion susceptibility. Bulk motion is more likely during long acquisitions, as they appear in diffusion tensor, diffusion spectrum and q-ball imaging. Image registration methods are successfully used to correct for bulk motion in other MRI time series, but their performance in diffusion-weighted MRI is limited since diffusion weighting introduces strong signal and contrast changes between serial image volumes. In this work, we combine the capability of free induction decay (FID) navigators, providing information on object motion, with image registration methodology to prospectively--or optionally retrospectively--correct for motion in diffusion imaging of the human brain. Eight healthy subjects were instructed to perform small-scale voluntary head motion during clinical diffusion tensor imaging acquisitions. The implemented motion detection based on FID navigator signals is processed in real-time and provided an excellent detection performance of voluntary motion patterns even at a sub-millimetre scale (sensitivity≥92%, specificity>98%). Motion detection triggered an additional image volume acquisition with b=0 s/mm2 which was subsequently co-registered to a reference volume. In the prospective correction scenario, the calculated motion-parameters were applied to perform a real-time update of the gradient coordinate system to correct for the head movement. Quantitative analysis revealed that the motion correction implementation is capable to correct head motion in diffusion-weighted MRI to a level comparable to scans without voluntary head motion. The results indicate the potential of this method to improve image quality in diffusion-weighted MRI, a concept that can also be applied when highest diffusion weightings are performed.
Resumo:
In searching for simple and reliable test methods to evaluate the quality of Iowa portland cement concrete (PCC) pavements, the Duggan test was conducted for concretes made of twenty-six types of cements in this laboratory research. The influence of some factors, such as chemical composition and type of cements, use of air-entraining agent and water reducer, and water to cement ratio, on the result of the Duggan test was examined. It was found that the expansion increases with increasing values of potassium alkali (K2O) and sulfur trioxide (SO3) in cements. It was also found that the Type I cements generally produce higher expansion than the Type II, IP and IS cements. Since it is difficult to identify the major mechanism leading to the expansion observed in the Duggan test, more studies are certainly needed before it can be used as a reliable test method for evaluating the service life of concrete pavement.
Resumo:
Selostus: Suomen maaperän fosforin tutkiminen 1900-luvulla ja viljavuustutkimuksen kehittäminen
Resumo:
GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.
Resumo:
A new paint testing device was built to determine the resistance of paints to darkening due to road grime being tracked onto them. The device consists of a tire rotating on a sample drum. Soil was applied to the tire and then tracked onto paint samples which were attached to the drum. A colorimeter was used to measure the lightness of the paints after being tracked. Lightness is measured from 0 (absolute black) to 100 (absolute white). Four experiments were run to determine the optimum time length to track a sample, the reproducibility, the effects of different soils, and the maximum acceptable level for darkening of a paint. The following conclusions were reached: 1) the optimum tracking time was 10 minutes; 2) the reproducibility had a standard deviation of 1.5 lightness units; 3) different soils did not have a large effect on the amount of darkening on the paints; 4) a maximum acceptable darkness could not be established based on the limited amount of data; and 5) a correlation exists between the paints which were darkening in the field and the paints which were turning the darkest on the tracking wheel.
Resumo:
This work proposes a parallel architecture for a motion estimation algorithm. It is well known that image processing requires a huge amount of computation, mainly at low level processing where the algorithms are dealing with a great numbers of data-pixel. One of the solutions to estimate motions involves detection of the correspondences between two images. Due to its regular processing scheme, parallel implementation of correspondence problem can be an adequate approach to reduce the computation time. This work introduces parallel and real-time implementation of such low-level tasks to be carried out from the moment that the current image is acquired by the camera until the pairs of point-matchings are detected
Resumo:
A comprehensive field detection method is proposed that is aimed at developing advanced capability for reliable monitoring, inspection and life estimation of bridge infrastructure. The goal is to utilize Motion-Sensing Radio Transponders (RFIDS) on fully adaptive bridge monitoring to minimize the problems inherent in human inspections of bridges. We developed a novel integrated condition-based maintenance (CBM) framework integrating transformative research in RFID sensors and sensing architecture, for in-situ scour monitoring, state-of-the-art computationally efficient multiscale modeling for scour assessment.
Resumo:
Research Project HR-124, "Development of a Laboratory Durability Test for Asphalts," was initiated in 1966 as a long-range comprehensive program. Its ultimate objective was to develop a simple, rapid laboratory test that could be used by highway engineers to select paving asphalt according to quality, to identify inferior asphalts, and to reasonably predict the useful life of asphalts once they were incorporated in the pavements.
Resumo:
Aim To evaluate the effects of using distinct alternative sets of climatic predictor variables on the performance, spatial predictions and future projections of species distribution models (SDMs) for rare plants in an arid environment. . Location Atacama and Peruvian Deserts, South America (18º30'S - 31º30'S, 0 - 3 000 m) Methods We modelled the present and future potential distributions of 13 species of Heliotropium sect. Cochranea, a plant group with a centre of diversity in the Atacama Desert. We developed and applied a sequential procedure, starting from climate monthly variables, to derive six alternative sets of climatic predictor variables. We used them to fit models with eight modelling techniques within an ensemble forecasting framework, and derived climate change projections for each of them. We evaluated the effects of using these alternative sets of predictor variables on performance, spatial predictions and projections of SDMs using Generalised Linear Mixed Models (GLMM). Results The use of distinct sets of climatic predictor variables did not have a significant effect on overall metrics of model performance, but had significant effects on present and future spatial predictions. Main conclusion Using different sets of climatic predictors can yield the same model fits but different spatial predictions of current and future species distributions. This represents a new form of uncertainty in model-based estimates of extinction risk that may need to be better acknowledged and quantified in future SDM studies.
Resumo:
The purpose of this study was to investigate the impact of in-plane coronary artery motion on coronary magnetic resonance angiography (MRA) and coronary MR vessel wall imaging. Free-breathing, navigator-gated, 3D-segmented k-space turbo field echo ((TFE)/echo-planar imaging (EPI)) coronary MRA and 2D fast spin-echo coronary vessel wall imaging of the right coronary artery (RCA) were performed in 15 healthy adult subjects. Images were acquired at two different diastolic time periods in each subject: 1) during a subject-specific diastasis period (in-plane velocity <4 cm/second) identified from analysis of in-plane coronary artery motion, and 2) using a diastolic trigger delay based on a previously implemented heart-rate-dependent empirical formula. RCA vessel wall imaging was only feasible with subject-specific middiastolic acquisition, while the coronary wall could not be identified with the heart-rate-dependent formula. For coronary MRA, RCA border definition was improved by 13% (P < 0.001) with the use of subject-specific trigger delay (vs. heart-rate-dependent delay). Subject-specific middiastolic image acquisition improves 3D TFE/EPI coronary MRA, and is critical for RCA vessel wall imaging.
Resumo:
OBJECTIVE: Imaging during a period of minimal myocardial motion is of paramount importance for coronary MR angiography (MRA). The objective of our study was to evaluate the utility of FREEZE, a custom-built automated tool for the identification of the period of minimal myocardial motion, in both a moving phantom at 1.5 T and 10 healthy adults (nine men, one woman; mean age, 24.9 years; age range, 21-32 years) at 3 T. CONCLUSION: Quantitative analysis of the moving phantom showed that dimension measurements approached those obtained in the static phantom when using FREEZE. In vitro, vessel sharpness, signal-to-noise ratio (SNR), and contrast-to-noise ratio (CNR) were significantly improved when coronary MRA was performed during the software-prescribed period of minimal myocardial motion (p < 0.05). Consistent with these objective findings, image quality assessments by consensus review also improved significantly when using the automated prescription of the period of minimal myocardial motion. The use of FREEZE improves image quality of coronary MRA. Simultaneously, operator dependence can be minimized while the ease of use is improved.