1000 resultados para Metodologia Ativa


Relevância:

20.00% 20.00%

Publicador:

Resumo:

This work develops a methodology for defining the maximum active power being injected into predefined nodes in the studied distribution networks, considering the possibility of multiple accesses of generating units. The definition of these maximum values is obtained from an optimization study, in which further losses should not exceed those of the base case, i.e., without the presence of distributed generation. The restrictions on the loading of the branches and voltages of the system are respected. To face the problem it is proposed an algorithm, which is based on the numerical method called particle swarm optimization, applied to the study of AC conventional load flow and optimal load flow for maximizing the penetration of distributed generation. Alternatively, the Newton-Raphson method was incorporated to resolution of the load flow. The computer program is performed with the SCILAB software. The proposed algorithm is tested with the data from the IEEE network with 14 nodes and from another network, this one from the Rio Grande do Norte State, at a high voltage (69 kV), with 25 nodes. The algorithm defines allowed values of nominal active power of distributed generation, in percentage terms relative to the demand of the network, from reference values

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The present work has as objective to present a method of project and implementation of controllers PID, based on industrial instrumentation. An automatic system of auto-tunning of controllers PID will be presented, for systems of first and second order. The software presented in this work is applied in controlled plants by PID controllers implemented in a CLP. Software is applied to make the auto-tunning of the parameters of controller PID of plants that need this tunning. Software presents two stages, the first one is the stage of identification of the system using the least square recursive algorithm and the second is the stage of project of the parameters of controller PID using the root locus algorithm. An important fact of this work is the use of industrial instrumentation for the accomplishment of the experiments. The experiments had been carried through in controlled real plants for controllers PID implemented in the CLP. Thus has not only one resulted obtained with theoreticians experiments made with computational programs, and yes resulted obtained of real systems. The experiments had shown good results gotten with developed software

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This paper presents methodology based on Lev Vigotsky`s social interactionist theory through investigative activities, which integrates the teaching of physics to robotics, directed to students of the Physics degree course, seeking to provide further training for future teachers. The method is organized through educational robotics workshops that addresses concepts of physics through the use of low-cost educational robots along with several activities. The methodology has been presented and discussed and put into practice afterwards in workshops so that these future teachers may be able to take robotics to their classroom. Students from the last and penultimate semester of the Physics degree course of the Federal Institute of Education, Science and Technology of Rio Grande do Norte, Caicó campus participated in this project

Relevância:

20.00% 20.00%

Publicador:

Resumo:

New materials made from industrial wastes have been studied as an alternative to traditional fabrication processes in building and civil engineering. These materials are produced considering some issues like: cost, efficiency and reduction of nvironmental damage. Specifically in cases of materials destined to dwellings in low latitude regions, like Brazilian Northeast, efficiency is related to mechanical and thermal resistance. Thus, when thermal insulation and energetic efficiency are aimed, it s important to increase thermal resistance without depletion of mechanical properties. This research was conducted on a construction element made of two plates of cement mortar, interspersed with a plate of recycled expanded polystyrene (EPS). This component, widely known as sandwich-panel, is commonly manufactured with commercial EPS whose substitution was proposed in this study. For this purpose it was applied a detailed methodology that defines parameters to a rational batching of the elements that constitute the nucleus. Samples of recycled EPS were made in two different values of apparent specific mass (ρ = 65 kg/m³; ρ = 130 kg/m³) and submitted to the Quick-Line 30TM that is a thermophysical properties analyzer. Based on the results of thermal conductivity, thermal capacity and thermal diffusivity obtained, it was possible to assure that recycled EPS has thermal insulation characteristics that qualify it to replace commercial EPS in building and civil engineering industry

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The competitiveness of the trade generated by the higher availability of products with lower quality and cost promoted a new reality of industrial production with small clearances. Track deviations at the production are not discarded, uncertainties can statistically occur. The world consumer and the Brazilian one are supported by the consumer protection code, in lawsuits against the products poor quality. An automobile is composed of various systems and thousands of constituent parts, increasing the likelihood of failure. The dynamic and security systems are critical in relation to the consequences of possible failures. The investigation of the failure gives us the possibility of learning and contributing to various improvements. Our main purpose in this work is to develop a systematic, specific methodology by investigating the root cause of the flaw occurred on an axle end of the front suspension of an automobile, and to perform comparative data analyses between the fractured part and the project information. Our research was based on a flaw generated in an automotive suspension system involved in a mechanical judicial cause, resulting in property and personal damages. In the investigations concerning the analysis of mechanical flaws, knowledge on materials engineering plays a crucial role in the process, since it enables applying techniques for characterizing materials, relating the technical attributes required from a respective part with its structure of manufacturing material, thus providing a greater scientific contribution to the work. The specific methodology developed follows its own flowchart. In the early phase, the data in the records and information on the involved ones were collected. The following laboratory analyses were performed: macrography of the fracture, micrography with SEM (Scanning Electron Microscope) of the initial and final fracture, phase analysis with optical microscopy, Brinell hardness and Vickers microhardness analyses, quantitative and qualitative chemical analysis, by using X-ray fluorescence and optical spectroscopy for carbon analysis, qualitative study on the state of tension was done. Field data were also collected. In the analyses data of the values resulting from the fractured stock parts and the design values were compared. After the investigation, one concluded that: the developed methodology systematized the investigation and enabled crossing data, thus minimizing diagnostic error probability, the morphology of the fracture indicates failure by the fatigue mechanism in a geometrically propitious location, a tension hub, the part was subjected to low tensions by the sectional area of the final fracture, the manufacturing material of the fractured part has low ductility, the component fractured in an earlier moment than the one recommended by the manufacturer, the percentages of C, Si, Mn and Cr of the fractured part present values which differ from the design ones, the hardness value of the superior limit of the fractured part is higher than that of the design, and there is no manufacturing uniformity between stock and fractured part. The work will contribute to optimizing the guidance of the actions in a mechanical engineering judicial expertise

Relevância:

20.00% 20.00%

Publicador:

Resumo:

On this research we investigated how new technologies can help the process of design and manufacturing of furniture in such small manufacturers in Rio Grande do Norte state. Google SketchUp, a 3D software tool, was developed in such a way that its internal structures are opened and can be accessed using SketchUp s API for Ruby and programs written in Ruby language (plugins). Using the concepts of the so-called Group Technology and the flexibility that enables adding new functionalities to this software, it was created a Methodology for Modeling of Furniture, a Coding System and a plugin for Google s tool in order to implement the Methodology developed. As resulted, the following facilities are available: the user may create and reuse the library s models over-and-over; reports of the materials manufacturing process costs are provided and, finally, detailed drawings, getting a better integration between the furniture design and manufacturing process

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Improving the adherence between oilwell metallic casing and cement sheath potentially decrease the number of corrective actions present/y necessary for Northeastern wells submitted to steam injection. In addition to the direct costs involved in the corrective operations, the economic impact of the failure of the primary cementing aIso includes the loss in the production of the well. The adherence between casing and cement is current/y evaluated by a simple shear tests non standardized by the American Petroleum Institute (API). Therefore, the objective of the present is to propose and evaluate a standardized method to assess the adherence of oilwell metallic casing to cement sheath. To that end, a section of a cemented oilwell was simulated and used to test the effect of different parameters on the shear stress of the system. Surface roughness and different cement compositions submitted or not to thermal cycling were evaluated. The results revealed that the test geometry and parameters proposed yielded different values for the shear stress of the system, corresponding to different adherent conditions between metallic casing and cement sheath

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The use of tetrazolium testing is recognized in the soybean seed quality control due to the large amount of data which it provides. Although it is considered a quick test, in 1998 an alternative methodology was proposed for the seed preconditioning, which allows 10 hours of time saving in seeds preparation. The objective of this research is to compare the accuracy of the new and the traditional tetrazolium testing. Three soybean seed genotypes were used, Conquista, Garantia and M-soy 8400, all 2000/2001 crop. The seeds were evaluated in relation to germination, evaluated with the traditional (TZt) and the alternative (Tza) tetrazolium test as well as with the accelerated aging performed in two different conditions (45 degrees C 24h(-1) and 45 degrees C 72h(-1)). After aging, the seeds too were submitted to TZt and Tza testing. The experimental design was a randomized blocks, with four replicates the 50 seeds per genotype in every evaluation, with exception only for tetrazolium test, with two replicates. The averages were compared in the Tukey test level of 5% probability. The comparison between the two methodologies in relation to level of vigor (class 1 to 3) and germination potential (class 1 to 5) indicated no statistical discrepancies, for aged non-aged seeds. This, the use of the alternative tetrazolium test is recommend in case a reduced seed preparation time is needed.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In the contemporary world to the deterioration of semi-arid areas of the planet has been the focus of media attention and the scientific community. Brazil has a semiarid, considered the most problematic of the world, either by pressure from physical factors, whether as a result of misguided public policies, has over time been suffering from the consequences of a deterioration that expands over the years. Methodologies, that amidst the problems of semi-arid, come against the deteriorating local, have a good chance to be reapplied in other contexts around the world. This research, based on methodological model for analyzing environmental deterioration, introduced and examined the applicability of the methodology in the semi-arid region of Rio Grande do Norte - Brazil. Although the results provide guidelines for the introduction of underground dams, the application of the methodology was ineffective, given the high rates of forest cover that gave low values for the physical diagnosis conservationist

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This paper aims at building a proposal for teaching of electromagnetism in the secondary level in the state public school in Natal, RN, encompassing at the most possible comprehensive manner the fundamental aspects of electromagnetism. The methodology employed here is prioritize physical concepts rather than instruments (such as the mathematics), which should have the connotation of just tools, or of aids in the context of physics teaching in the referred teaching level. The proposal is to give teachers a consultation resource, from differentiated lesson plans, which have as main focus activities based primarily in texts and active participation of students in the teaching- learning process and the implementation of the PCN+ proposals (BRAZIL, 2000), which suggest alternative ways to make the practice in the classroom more exciting, targeting a significant teaching-learning process for both the teacher and the student. This material was applied during the 3rd and 4th term (i.e., bimester) throughout the school year of 2007, in the State School Teacher Varela Barca in two classes (3V1 and 3V2) of 3rd grade of secondary level. As evaluation of the implementation of this proposal one can cite that students were more secure when to apply the concepts, when conducting the experiments, and less anxious when formal evaluation of the evidence, showing greater motivation when presented to electromagnetism contextualized in their everyday situations. The product of this educational work includes, besides the dissertation, the lesson plans, itineraries and experimental assessment of the instruments used (Annex E to I)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This present work is going to show some results developed in the Master Degree research and the Post Graduation project in Language studies (PPgEL) at UFRN, under the orientation of Professor Maria da Penha Casado Alves. This research has questions showed by the Programa Nacional de Inclusão de Jovens PROJOVEM. Concerned to methodology, the research is based on Applied Linguistics and it is qualitative and documental. The corpus of the research are the Manual de Orientações Gerais and the Guias de Estudo. The documents that were used for the research were Guide for general orientation and the Study Guides.The Manual de Orientações Gerais was chosen because is focused on the teacher and the Guias de Estudo was chosen because are focused on the students. The discussions and analysis were based on Bakhtin (1997; 2003), for his studies about the language in a dialogical point of view, Faraco (2001 and 2008) and Suassuna (2006) for their discussions about the Portuguese Language and Geraldi (1997; 2005 and 2006) and Antunes (2003) for their orientation and discussions about the teaching process of the written language. The analysis made in the Reference Topics point that however the program proposes a kind of rupture with the traditional way of teaching, it could not take this change to the Study Guides (Guias de Estudo). The result is a didactic material that reproduces activities based on a conception of a descriptive and prescriptive teaching. What is concerned about the proposals for the textual production, it is shown that it is given in an artificial way, without any expression and with no link to any communicative context and sometimes, with no relation to the topic it was supposed to be related to

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Este artigo apresenta os principais resultados e o detalhamento da metodologia e equações de controle de um retificador monofásico pré-regulador de 150kW para sistema trólebus. A estrutura proposta possibilita a Correção ativa do Fator de Potência (CFP) com baixos níveis de Distorção Harmônica Total (DHT) na corrente, em conformidade com a norma internacional IEC 61000-3-4. Fruto de um projeto de Pesquisa, Desenvolvimento e Inovação (P) junto à empresa AES Eletropaulo Metropolitana de São Paulo, em parceria com a empresa de transporte Himalaia S.A., o projeto possui como principais objetivos estimular o interesse para a expansão das linhas de trólebus a partir de uma plataforma de alimentação de menor custo de instalação e manutenção, sem a necessidade de subestações retificadoras, e, com vistas a promover a melhoria da qualidade de vida nos grandes centros urbanos. Nessa nova modalidade proposta para o sistema de alimentação, o trólebus pode ser alimentado tanto pelas redes convencionais em corrente contínua (CC) quanto pelas redes de distribuição em corrente alternada (CA), mantendo-se a disposição a dois fios dos sistemas CC, sendo as mudanças de rede de alimentação (CC ou CA) monitoradas e controladas digitalmente. Todo o sistema de gerenciamento e controle do conversor é realizado digitalmente por FPGA XC3S200. Na evolução do sistema proposto, os autores pretendem inclusive eliminar as linhas aéreas de alimentação, através da utilização de postos de alimentação em CA, especialmente desenvolvidos para os pontos de embarque/desembarque de passageiros para este veículo de transporte coletivo, eliminando-se os aspectos visuais negativos das redes de alimentação deste modal, e, reduzindo-se as falhas de operação do sistema.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

O método de fluxo de carga convencional é considerado inadequado para se obter o ponto de máximo carregamento (PMC) de sistemas de potência, devido à singularidade da matriz Jacobiana neste ponto. Os métodos da continuação são ferramentas eficientes para a solução deste tipo de problema, visto que técnicas de parametrização podem ser utilizadas para evitar a singularidade da matriz Jacobiana. Neste trabalho, novas opções para a etapa de parametrização do método da continuação são apresentadas. Mostra-se que variáveis com claro significado físico podem ser utilizadas na etapa de parametrização. As seguintes variáveis foram testadas: perda total de potência ativa e reativa, potência ativa e reativa na barra de referência, potência reativa das barras de geração, e as perdas de potência ativa e reativa nas linhas de transmissão (LT). Além de facilitar a implementação computacional do método de continuação, as técnicas de parametrização apresentadas simplificam a definição matemática e o entendimento do método por parte de engenheiros de potência, visto que os métodos de continuação existentes na literatura sempre utilizam técnicas de parametrização complexas, e de interpretação puramente geométrica. Resultados obtidos com a nova metodologia para os sistemas testes do IEEE (14, 30, 57 e 118 barras) mostram que as características de convergência do método de fluxo de carga convencional são melhoradas na região do PMC. Além disso, durante o traçado das curvas PV, as diversas técnicas de parametrização podem ser comutadas entre si possibilitando o cálculo de todos os pontos da curva com um número reduzido de iterações. Diversos testes são realizados para proporcionar a comparação do desempenho dos esquemas de parametrização propostos.