978 resultados para Endothelial cell
Resumo:
Cultured human umbilical vein endothelial cells (EC) constitutively express a low level of CD40 antigen as detected by monoclonal antibody binding and fluorescence flow cytometric quantitation. The level of expression on EC is increased about 3-fold following 24 h treatment with optimal concentrations of tumor necrosis factor, interleukin 1, interferon beta, or interferon gamma; both interferons show greater than additive induction of CD40 when combined with tumor necrosis factor or interleukin 1. Expression of CD40 increases within 8 h of cytokine treatment and continues to increase through 72 h. A trimeric form of recombinant murine CD40 ligand acts on human EC to increase expression of leukocyte adhesion molecules, including E-selectin, vascular cell adhesion molecule 1, and intercellular adhesion molecule 1. CD40 may be detected immunocytochemically on human microvascular EC in normal skin. We conclude that endothelial CD40 may play a role as a signaling receptor in the development of T-cell-mediated inflammatory reactions.
Resumo:
Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.
Resumo:
Editorial
Resumo:
Sickle cell anemia (SCA) is an autosomal recessive chronic hemolytic anemia, caused by homozygosity for the HBB:c.20A>T mutation. The disease presents with high clinical heterogeneity, stroke being the most devastating manifestation. This study aimed to identify genetic modulators of severe hemolysis and stroke risk in children with SCA, as well as understand their consequences at the hemorheological level. Sixty-six children with SCA were categorised according to their degree of cerebral vasculopathy (Stroke/Risk/Control). Relevant data were collected from patients’ medical records. Several polymorphic regions in genes related to vascular cell adhesion and tonus were characterized by molecular methodologies. Data analyses were performed using R software. Several in silico tools (e.g. TFBind, MatInspector) were applied to investigate the main variant consequences. Some genetic variants in vascular adhesion molecule-1 gene promoter and endothelial nitric oxide synthase gene were associated with higher levels of hemolysis and stroke events. They modify important transcription factor binding sites or disturb the corresponding protein structure/function. Our findings emphasize the relevance of the genetic variants in modulating the degree of hemolysis and development of cerebral vasculopathy due to their effect on gene expression, modification of protein biological activities related with erythrocyte/endothelial interactions and consequent hemorheological abnormalities in SCA.
Resumo:
PURPOSE To evaluate macular retinal ganglion cell thickness in patients with neovascular age-related macular degeneration (AMD) and intravitreal anti-vascular endothelial growth factor (VEGF) therapy. DESIGN Retrospective case series with fellow-eye comparison METHODS: Patients with continuous unilateral anti-VEGF treatment for sub- and juxtafoveal neovascular AMD and a minimum follow-up of 24 months were included. The retinal nerve fiber (RNFL) and retinal ganglion cell layer (RGCL) in the macula were segmented using an ETDRS grid. RNFL and RGCL thickness of the outer ring of the ETDRS grid were quantified at baseline and after repeated anti-VEGF injections, and compared to the patients' untreated fellow eye. Furthermore, best-corrected visual acuity (BCVA), age, and retinal pigment epithelium (RPE) atrophy were recorded and correlated with RNFL and RGCL. RESULTS Sixty eight eyes of 34 patients (23 female and 11 male; mean age 76.7 (SD±8.2) with a mean number of 31.5 (SD ±9.8) anti-VEGF injections and a mean follow-up period of 45.3 months (SD±10.5) were included. Whereas the RGCL thickness decreased significantly compared to the non-injected fellow eye (p=0.01) the decrease of the RNFL was not significant. Visual acuity gain was significantly correlated with RGCL thickness (r=0.52, p<0.05) at follow-up and negatively correlated (r=-0.41, p<0.05) with age. Presence of RPE atrophy correlated negatively with the RGCL thickness at follow-up (r= -0.37, p=0.03). CONCLUSION During the course of long term anti-VEGF therapy there is a significant decrease of the RGCL in patients with neovascular AMD to the fellow (untreated) eye.
Resumo:
Thesis (Ph.D.)--University of Washington, 2016-06
Resumo:
Individuals with periodontitis have been reported to have a significantly increased risk of developing coronary heart disease. Several studies have demonstrated that the immune response to heat shock protein 60 (HSP60) may be involved in the pathogenesis of both atherosclerosis and chronic periodontitis. To investigate this possible link between these diseases, cellular and humoral immune responses to HSP60 in atherosclerosis patients were compared with those in periodontitis patients and healthy subjects using human and Porphyromonas gingivalis HSP60 (GroEL) as antigens. Antibody levels to both human and P. gingivalis HSP60s were the highest in atherosclerosis patients, followed by periodontitis patients and healthy subjects. Clonal analysis of the T cells clearly demonstrated the presence of not only human HSP60- but also P. gingivalis GroEL-reactive T-cell populations in the peripheral circulation of atherosclerosis patients. Furthermore, these HSP60-reactive T cells seemed to be present in atherosclerotic lesions in some patients. These results suggest that T-cell clones with the same specificity may be involved in the pathogenesis of the different diseases.
Resumo:
The expression and function of nicotinic ACh receptors (nAChRs) in rat coronary microvascular endothelial cells (CMECs) were examined using RT-PCR and whole cell patch-clamp recording methods. RT-PCR revealed expression of mRNA encoding for the subunits alpha(2), alpha(3), alpha(4), alpha(5), alpha(7), beta(2), and beta(4) but not beta(3). Focal application of ACh evoked an inward current in isolated CMECs voltage clamped at negative membrane potentials. The current-voltage relationship of the ACh-induced current exhibited marked inward rectification and a reversal potential (E-rev) close to 0 mV. The cholinergic agonists nicotine, epibatidine, and cytisine activated membrane currents similar to those evoked by ACh. The nicotine-induced current was abolished by the neuronal nAChR antagonist mecamylamine. The direction and magnitude of the shift in E-rev of nicotine-induced current as a function of extracellular Na+ concentration indicate that the nAChR channel is cation selective and follows that predicted by the Goldman-Hodgkin-Katz equation assuming K+/Na+ permeability ratio of 1.11. In fura-2-loaded CMECs, application of ACh, but not of nicotine, elicited a transient increase in intracellular free Ca2+ concentration. Taken together, these results demonstrate that neuronal nAChR activation by cholinergic agonists evokes an inward current in CMECs carried primarily by Na+, which may contribute to the plasma nicotine-induced changes in microvascular permeability and reactivity induced by elevations in plasma nicotine.
Resumo:
The presence of primary cilia in corneal endothelial cells of a range of species from six non-mammalian vertebrate classes (Agnatha, Elasmobranchii, Amphibia, Teleostei, Reptilia, and Aves) is examined by scanning and transmission electron microscopy. Our aim is to assess whether these non-motile cilia protruding into the anterior chamber of the eye are a consistent phylogenetic feature of the corneal endothelium and if a quantitative comparison of their morphology is able to shed any new light on their function. The length (0.42-3.80 mum) and width (0.12-0.44 mum) of the primary cilia varied but were closely allied with previous studies in mammals. However, interspecific differences such as the presence of a terminal swelling in the Teleostei and Amphibia suggest there are functional differences. Approximately one-third of the endothelial cells possess cilia but the extent of protrusion above the cell surface varies greatly, supporting a dynamic process of retraction and elongation. The absence of primary cilia in primitive vertebrates (Agnatha and Elasmobranchii) that possess other mechanisms to control corneal hydration suggests an osmoregulatory and/or chemosensory function. (C) 2003 Elsevier Ltd. All rights reserved.
Resumo:
The nuclear localization of a number of growth factors, cytokine ligands and their receptors has been reported in various cell lines and tissues. These include members of the fibroblast growth factor (FGF), epidermal growth factor and growth hormone families. Accordingly, a number of nuclear functions have begun to emerge for these protein families. The demonstration of functional interactions of these proteins with the nuclear import machinery has further supported their functions as nuclear signal transducers. Here, we review the membrane- trafficking machinery and pathways demonstrated to regulate this cell surface to nucleus-trafficking event and highlight the many remaining unanswered questions. We focus on the FGF family, which is providing many of the clues as to the process of this unusual phenomenon.
Resumo:
Dendritic cell (DC) defects are an important component of immunosuppression in cancer. Here, we assessed whether cancer could affect circulating DC populations and its correlation with tumor progression. The blood DC compartment was evaluated in 136 patients with breast cancer, prostate cancer, and malignant glioma. Phenotypic, quantitative, and functional analyses were performed at various stages of disease. Patients had significantly fewer circulating myeloid (CD11c(+)) and plasmacytoid (CD123(+)) DC, and a concurrent accumulation of CD11c(-)CD123(-) immature cells that expressed high levels of HLA-DR+ immature cells (DR+IC). Although DR+IC exhibited a limited expression of markers ascribed to mature hematopoietic lineages, expression of HLA-DR, CD40, and CD86 suggested a role as antigen-presenting cells. Nevertheless, DR+IC had reduced capacity to capture antigens and elicited poor proliferation and interferon-gamma secretion by T-lymphocytes. Importantly, increased numbers of DR+IC correlated with disease status. Patients with metastatic breast cancer showed a larger number of DR+IC in the circulation than patients with local/nodal disease. Similarly, in patients with fully resected glioma, the proportion of DR+IC in the blood increased when evaluation indicated tumor recurrence. Reduction of blood DC correlating with accumulation of a population of immature cells with poor immunologic function may be associated with increased immunodeficiency observed in cancer.
Resumo:
To address the issue of melanocortin-1 receptor (MC1R) expression in non-melanocytic cells, we have quantitatively evaluated the relative expression levels of both MC1R mRNA and protein in a subset of different cell types. Using semi-quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) at high cycle numbers, we detected MC1R mRNA in all cell types examined, including human embryonic kidney-293 (HEK 293) cells, a cell type widely used as a negative control in melanocortin expression studies. Quantitative real-time PCR revealed the highest levels of MC1R transcripts were in melanocytic cells, whereas the keratinocyte and fibroblast cell cultures examined had only a low level of expression, similar to that of HEK 293 cells. Antibody mediated detection of MC1R protein in membrane extracts demonstrated exogenous receptor in MC1R transfected cell lines, as well as endogenous MC1R in melanoma cells. However, radioligand binding procedures were required to detect MC1R protein of normal human melanocytes and no surface expression of MC1R was detected in any of the non-melanocytic cells examined. This was consistent with their low level of mRNA, and suggests that, if present, the levels of surface receptor are significantly lower than that in melanocytes. The capacity of such limited levels of MC1R protein to influence non-melanocytic skin cell biology would likely be severely compromised. Indeed, the MC1R agonist [NIe(4), D-Phe(7)] alpha-melanocyte stimulating hormone (NDP-MSH) was unable to elevate intracellular cyclic adenosine monophosphate (cAMP) levels in the keratinocyte and fibroblast cells examined, whereas a robust increase was elicited in melanocytes. Although there are a variety of cell types with detectable MC1R mRNA, the expression of physiologically significant levels of the receptor may be more restricted than the current literature indicates, and within epidermal tissue may be limited to the melanocyte
Resumo:
The efficacy of antioxidant supplementation in the prevention of cardiovascular disease appears equivocal, however the use of more potent antioxidant combinations than those traditionally used may exert a more positive effect. We have shown previously that supplementation of vitamin E and α-lipoic acid increases cardiac performance during post-ischemia reperfusion in older rats and increases Bcl-2 levels in endothelial cells. The purpose of this study was to examine the effects of vitamin E and α-lipoic acid supplementation on myocardial gene expression with a view to determine their mechanism of action. Young male rats received either a control (n=7) or vitamin E and α-lipoic acid supplemented diet (n=8) for 14 weeks. RNA from myocardial tissue was then amplified and samples were pooled within groups and competitively hybridized to 5K oligonucleotide rat microarrays. The relative expression of each gene was then compared to the control sample. Animals that received the antioxidant-supplemented diet exhibited upregulation (>1.5×) of 13 genes in the myocardium with 2 genes downregulated.� �Upregulated genes include those involved in cell growth and maintenance (LynB, Csf1r, Akt2, Tp53), cell signaling (LynB, Csf1r) and signal transduction (Pacsin2, Csf1r). Downregulated genes encode thyroid (Thrsp) and F-actin binding proteins (Nexilin).
Resumo:
Background: Human islet transplantation would offer a less invasive and more physiological alternative than whole pancreas transplantation and insulin injections respectively for the treatment of diabetes mellitus if islet graft survival can be improved. Initial recipient post-transplant insulin independence declines to <10% after 5 years. Factors contributing to graft failure include enzymatic disruption of the islet microenvironment during isolation, diabetogenic effects of immunosuppressants and metabolic stress resulting from slow revascularisation. Aims: To investigate the effect of co-culture in both static (SC) and rotational culture (RC) of BRINBDII beta-cells (Dl1) and human umbilical vein endothelial cells (HUVEC) on Dl1 insulin secretion; and the effect of a thiazolidinedione (TZD) on DII function and HUVEC proliferation. To assess the effect of culture media, SC, RC and a TZD on human islet morphology, insulin secretion and VEGF production. To initiate in vivo protocol development for assessment of revascularisation of human islet grafts. Methods: D11 cells were cultured +/-TZD and co-cultured with HUVEC +/-TZD in SC and RC. Dl1 insulin secretion was induced by static incubation with low glucose (1.67mM), high glucose (l6.7mM: and high glucose with 10mM theophylline (G+T) and determined by ELISA. HUVEC were cultured +/-TZD in SC and RC and proliferation was assessed by ATP luminescence assay and VEGF ELISA. D II and HUVEC morphology was determined by immunocytochemistry. Human islets were cultured in SC and RC in various media +/-TZD. Insulin secretion was determined as above and VEGF production by fluorescence immunocytochemistry (FI) and ELISA. Revascularisation of islet grafts was assessed by vascular corrosion cast and FI. Results: Dll cultures showed significantly increased insulin secretion in response to 16.7mM and G+T over basal; this was enhanced by RC and further improved by adding 10mM TZD. Untreated Dll/HUVEC co-cultures displayed significantly increased insulin secretion in response to 16.7mM and G+T over basal, again enhanced by RC and improved with 10mM TZD. 10mM TZD significantly increased HUVEC proliferation over control. Human islets maintained in medium 199 (mI99) in SC and RC exhibited comparable maintenance of morphology and insulin secretory profiles compared to islets maintained in RPMI, endothelial growth media and dedicated islet medium Miami# I. All cultures showed significantly increased insulin secretion in response to 16.7mM and G+T over basal; this was enhanced by RC and in certain instances further improved by adding 25mM TZD. TZD increased VEGF production and release as determined by ELISA. Post-implant vascular corrosion casts of mouse kidneys analysed by x-ray micro tomography indicates a possible TZD enhancement of microvessel growth via VEGF upregulation. Conclusions: D II /HUVEC co-culture in SC or RC does not alter the morphology of either cell type and supports D 11 function. TZD improves 0 I I and D I I/HUVEC SC and RC co-culture insulin secretion while increasing HUVEC proliferation. Human islet RC supports islet functional viability and structural integrity compared to SC while the addition of TZD occasionally further improves secretagogue induced insulin secretion. Expensive, 'dedicated' islet media showed no advantage over ml99 in terms of maintaining islet morphology or function. TZD upregulates VEGF in islets as shown by ELISA and suggested by x-ray micro tomography analysis of vascular corrosion casts. Maintenance of islets in RC and treatment with TZD prior to transplant may improve the functional viability and revascularisation rate of islet grafts.