Effects of metformin treatment on luteal phase progesterone concentration in polycystic ovary syndrome

The causes of luteal phase progesterone deficiency in polycystic ovary syndrome (PCOS) are not known. To determine the possible involvement of hyperinsulinemia in luteal phase progesterone deficiency in women with PCOS, we examined the relationship between progesterone, luteinizing hormone (LH) and insulin during the luteal phase and studied the effect of metformin on luteal progesterone levels in PCOS. Patients with PCOS (19 women aged 18-35 years) were treated with metformin (500 mg three times daily) for 4 weeks prior to the test cycle and throughout the study period, and submitted to ovulation induction with clomiphene citrate. Blood samples were collected from control (N = 5, same age range as PCOS women) and PCOS women during the late follicular (one sample) and luteal (3 samples) phases and LH, insulin and progesterone concentrations were determined. Results were analyzed by one-way analysis of variance (ANOVA), Duncan's test and Karl Pearson's coefficient of correlation (r). The endocrine study showed low progesterone level (4.9 ng/ml) during luteal phase in the PCOS women as compared with control (21.6 ng/ml). A significant negative correlation was observed between insulin and progesterone (r = -0.60; P < 0.01) and between progesterone and LH (r = -0.56; P < 0.05) concentrations, and a positive correlation (r = 0.83; P < 0.001) was observed between LH and insulin. The study further demonstrated a significant enhancement in luteal progesterone concentration (16.97 ng/ml) in PCOS women treated with metformin. The results suggest that hyperinsulinemia/insulin resistance may be responsible for low progesterone levels during the luteal phase in PCOS. The luteal progesterone level may be enhanced in PCOS by decreasing insulin secretion with metformin.

Congenital ventricular septal defects and prenatal exposure to cyclooxygenase inhibitors

Ventricular septal defects (VSDs) are common congenital abnormalities which have been reported to be associated with maternal fever and various environmental factors. The aim of the present study was to evaluate the effect of prenatal exposure to cyclooxygenase (COX) inhibitors on heart defects. A retrospective statistical analysis was performed using data collected in our laboratory during various teratological studies carried out on albino CRL:(WI)WUBR Wistar strain rats from 1997 to 2004. The observations were compared with concurrent and historic control data, as well as findings from other developmental toxicological studies with selective and nonselective COX-2 inhibitors. Despite the lack of significant differences in the frequency of VSDs between drug-exposed and control groups, statistical analysis by the two-sided Mantel-Haenszel test and historical control data showed a higher incidence of heart defects in offspring exposed to nonselective COX inhibitors (30.06/10,000). Unlike other specific inhibitors, aspirin (46.26/10,000) and ibuprofen (106.95/10,000) significantly increased the incidence of the VSD when compared with various control groups (5.38-19.72/10,000). No significant differences in length or weight were detected between fetuses exposed to COX inhibitors and born with VSD and non-malformed offsprings. However, a statistically significant increase of fetal body length and decrease of body mass index were found in fetuses exposed to COX inhibitors when compared with untreated control. We conclude that prenatal exposure to COX inhibitors, especially aspirin and ibuprofen, increased the incidence of VSDs in rat offspring but was not related to fetal growth retardation.

Elevated amniotic fluid amino acid levels in fetuses with gastroschisis

Our objective was to measure maternal plasma and amniotic fluid amino acid concentrations in pregnant women diagnosed as having fetuses with gastroschisis in the second trimester of pregnancy. Twenty-one pregnant women who had fetuses with gastroschisis detected by ultrasonography (gastroschisis group) in the second trimester and 32 women who had abnormal triple screenings indicating an increased risk for Down syndrome but had healthy fetuses (control group) were enrolled in the study. Amniotic fluid was obtained by amniocentesis, and maternal plasma samples were taken simultaneously. The chromosomal analysis of the study and control groups was normal. Levels of free amino acids and non-essential amino acids were measured in plasma and amniotic fluid samples using EZ:fast kits (EZ:fast GC/FID free (physiological) amino acid kit) by gas chromatography (Focus GC AI 3000 Thermo Finnigan analyzer). The mean levels of essential amino acids (histidine, isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan, and valine) and non-essential amino acids (alanine, glycine, proline, and tyrosine) in amniotic fluid were found to be significantly higher in fetuses with gastroschisis than in the control group (P < 0.05). A significant positive correlation between maternal plasma and amniotic fluid concentrations of essential and nonessential amino acids was found only in the gastroschisis group (P < 0.05). The detection of significantly higher amino acid concentrations in the amniotic fluid of fetuses with a gastroschisis defect than in healthy fetuses suggests the occurrence of amino acid malabsorption or of amino acid leakage from the fetus into amniotic fluid.

Immunoglobulin production is impaired in protein-deprived mice and can be restored by dietary protein supplementation

Most contacts with food protein and microbiota antigens occur at the level of the gut mucosa. In animal models where this natural stimulation is absent, such as germ-free and antigen-free mice, the gut-associated lymphoid tissue (GALT) and systemic immunological activities are underdeveloped. We have shown that food proteins play a critical role in the full development of the immune system. C57BL/6 mice weaned to a diet in which intact proteins are replaced by equivalent amounts of amino acids (Aa diet) have a poorly developed GALT as well as low levels of serum immunoglobulins (total Ig, IgG, and IgA, but not IgM). In the present study, we evaluated whether the introduction of a protein-containing diet in 10 adult Aa-fed C57BL/6 mice could restore their immunoglobulin levels and whether this recovery was dependent on the amount of dietary protein. After the introduction of a casein-containing diet, Aa-fed mice presented a fast recovery (after 7 days) of secretory IgA (from 0.33 to 0.75 mg/mL, while in casein-fed mice this value was 0.81 mg/mL) and serum immunoglobulin levels (from 5.39 to 10.25 mg/mL of total Ig). Five percent dietary casein was enough to promote the restoration of secretory IgA and serum immunoglobulin levels to a normal range after 30 days feeding casein diet (as in casein-fed mice - 15% by weight of diet). These data suggest that the defect detected in the immunoglobulin levels was a reversible result of the absence of food proteins as an antigenic stimulus. They also indicate that the deleterious consequences of malnutrition at an early age for some immune functions may be restored by therapeutic intervention later in life.

Transient high-level expression of ß-galactosidase after transfection of fibroblasts from GM1 gangliosidosis patients with plasmid DNA

GM1 gangliosidosis is an autosomal recessive disorder caused by the deficiency of lysosomal acid hydrolase ß-galactosidase (ß-Gal). It is one of the most frequent lysosomal storage disorders in Brazil, with an estimated frequency of 1:17,000. The enzyme is secreted and can be captured by deficient cells and targeted to the lysosomes. There is no effective treatment for GM1 gangliosidosis. To determine the efficiency of an expression vector for correcting the genetic defect of GM1 gangliosidosis, we tested transfer of the ß-Gal gene (Glb1) to fibroblasts in culture using liposomes. ß-Gal cDNA was cloned into the expression vectors pSCTOP and pREP9. Transfection was performed using 4 µL lipofectamine 2000 and 1.5-2.0 µg DNA. Cells (2 x 10(5)/well) were harvested 24 h, 48 h, and 7 days after transfection. Enzyme specific activity was measured in cell lysate and supernatant by fluorometric assay. Twenty-four hours after transfection, treated cells showed a higher enzyme specific activity (pREP9-ß-Gal: 621.5 ± 323.0, pSCTOP-ß-Gal: 714.5 ± 349.5, pREP9-ß-Gal + pSCTOP-ß-Gal: 1859.0 ± 182.4, and pREP9-ß-Gal + pTRACER: 979.5 ± 254.9 nmol·h-1·mg-1 protein) compared to untreated cells (18.0 ± 3.1 for cell and 32.2 ± 22.2 nmol·h-1·mg-1 protein for supernatant). However, cells maintained in culture for 7 days showed values similar to those of untreated patients. In the present study, we were able to transfect primary patients' skin fibroblasts in culture using a non-viral vector which overexpresses the ß-Gal gene for 24 h. This is the first attempt to correct fibroblasts from patients with GM1 gangliosidosis by gene therapy using a non-viral vector.

Oculo-facio-cardio-dental syndrome in three succeeding generations: genotypic data and phenotypic features

Oculo-facio-cardio-dental (OFCD) syndrome is a rare X-linked disorder mainly manifesting in females. Patients show ocular, facial, cardiac, and dental abnormalities. OFCD syndrome is caused by heterozygous mutations in the BCOR gene, located in Xp11.4, encoding the BCL6 co-repressor. We report a Croatian family with four female members (grandmother, mother and monozygotic female twins) diagnosed with OFCD syndrome who carry the novel BCOR mutation c.4438C>T (p.R1480*). They present high intrafamilial phenotypic variability with special regard to cardiac defect and cataract that showed more severe disease expression in successive generations. Clinical and radiographic examination of the mother of the twins revealed a talon cusp involving the permanent maxillary right central incisor. This is the first known report of a talon cusp in OFCD syndrome with a novel mutation in the BCOR gene.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

MFG-E8, a clearance glycoprotein of apoptotic cells, as a new marker of disease severity in chronic obstructive pulmonary disease

Milk fat globule epidermal growth factor 8 (MFG-E8) is an opsonin involved in the phagocytosis of apoptotic cells. In patients with chronic obstructive pulmonary disease (COPD), apoptotic cell clearance is defective. However, whether aberrant MFG-E8 expression is involved in this defect is unknown. In this study, we examined the expression of MFG-E8 in COPD patients. MFG-E8, interleukin (IL)-1β and transforming growth factor (TGF)-β levels were measured in the plasma of 96 COPD patients (93 males, 3 females; age range: 62.12±10.39) and 87 age-matched healthy controls (85 males, 2 females; age range: 64.81±10.11 years) using an enzyme-linked immunosorbent assay. Compared with controls, COPD patients had a significantly lower plasma MFG-E8 levels (P<0.01) and significantly higher plasma TGF-β levels (P=0.002), whereas there was no difference in plasma IL-1β levels between the two groups. Moreover, plasma MFG-E8 levels decreased progressively between Global Initiative for Chronic Obstructive Lung Disease (GOLD) I and GOLD IV stage COPD. Multiple regression analysis showed that the forced expiratory volume in 1 s (FEV1 % predicted) and smoking habit were powerful predictors of MFG-E8 in COPD (P<0.01 and P=0.026, respectively). MFG-E8 was positively associated with the FEV1 % predicted and negatively associated with smoking habit. The area under the receiver operating characteristic curve was 0.874 (95% confidence interval: 0.798-0.95; P<0.01). Our findings demonstrated the utility of MFG-E8 as a marker of disease severity in COPD and that cigarette smoke impaired MFG-E8 expression in these patients.

Concentração de suco de laranja (Citrus sinensis) por osmose inversa

A concentração de suco de laranja por osmose inversa combinada com ultrafiltração foi estudada em escala semi-piloto, visando avaliar a utilização dessa tecnologia para substituição parcial da evaporação. Foram utilizados no processamento 100 litros de suco de laranja, com teor de polpa de 1,5%, cedidos pela CTM Citrus. Na primeira etapa, todo o suco passou pela etapa de ultrafiltração, para separação da polpa, enzimas pectinolíticas e microrganismos, que foram retidos. Foi utilizada uma membrana da Romicom (HF-43) de polissulfona em um sistema de configuração tubular, com peso molecular de corte de 50.000 daltons, à pressão de 1,2 bar. Obteve-se um fator de concentração de 27,6. O retentado da ultrafiltração foi pasteurizado à temperatura de 90°C, em trocador de calor de superfície raspada desenvolvido para este projeto. O processo de osmose inversa foi conduzido no equipamento Lab-unit M-20 da DDS, utilizando membranas da DDS (HR 95 PP) de filme composto em um sistema de configuração quadro e placas. Foram realizados três tratamentos com pressões de 20, 40 e 60 bar e para cada experimento, foram feitas três repetições. O retentado pasteurizado da ultrafiltração foi adicionado ao retentado da osmose inversa e caracterizado química, física e sensorialmente. Na osmose inversa foram obtidos fatores de concentração de 2,7, 3,5 e 3,6 e teores de sólidos solúveis de 18, 23 e 30 °Brix, para os tratamentos de 20, 40 e 60 bar, respectivamente. Os respectivos permeados apresentaram teores de sólidos solúveis de 3,3, 1,3 e 0,3°Brix e acidez de 262,50, 91,50 e 34,25 mg de ácido cítrico/100 ml. Os sucos obtidos pelos três tratamentos apresentaram valores de "defect score" e "color score" superiores aos do suco original, enquanto que para o "flavor score", os sucos obtidos às pressões de 40 e 60 bar, apresentaram valores próximos ao ideal. Os valores de "ratio", pH e formol foram semelhantes entre os tratamentos. O teor de óleo foi maior no tratamento realizado à menor pressão enquanto que o teor de vitamina C foi maior no de maior pressão. Tanto o suco concentrado quanto o diluído, nos três tratamentos, foram caracterizados como fluidos Newtonianos, apresentando valores de viscosidade maiores quando obtidos a maiores pressões.

Graduale (MS A.ö.II.55, Ilmajoen graduale)

A graduale (defect) from Ilmajoki. Written in three parts, part I (fols. 1-134) dating probably from the 1540's, part II (fols. 135-140) probably from the 1550's and part III (fols. 141-194) from the 1530's.

Missale (C.ö.IV.9, Oripään missale II)

A (mainly votive) missal consisting of seven distinct parts. Put together in several stages, somewhat haphazardly. Parts II and III are probably the oldest parts. The final stage in the composition of the book is probably the addition of part VII. Part II belongs in the same liturgical tradition as C.ö.IV.7 (Oripään Missale I), probably that of Diocese of Linköping. Part III, a votive missal, is an informal copy of a book that would most probably have been used close to a Swedish cathedral (Linköping?). How the present book found its way to Oripää chapel is not known.

Ohjelmistotestauksen käytänteet Suomessa

Ohjelmistotestauksen merkitys on kasvanut sen mukaan mitä enemmän ohjelmisto-tuotteet vaikuttavat jokapäiväisesseen elämämme. Tämän vuoksi yritysten investointien ja laadunvarmentamisen yhteys on ilmeinen. Organisaatiot panostavat yhä enemmän ei–funktionaaliseen testaukseen, kuten turvallisuuden, suorituskyvyn ja käytettävyyden testaamiseen. Tämän työn tarkoituksena on tutkia ohjelmistotestauksen nykytilannetta Suomessa. Syy tähän on uudistaa ja parantaa ohjelmistotestauksen kurssitarjontaa Turun yliopistossa vastaamaan parhaalla mahdollisella tavalla yritysten tarvetta. Opinnäyte on toteutettu replikaatio-tutkimuksena. Pääosa kyselystä sisältää kysymyksiä ohjelmistotestauksen menetelmistä ja työkaluista testausprosessin toimintojen aikana. Lisäksi on yleisiä kysymyksiä yrityksistä ja niiden ohjelmistotestausympäristöistä. Kyselyssä otetaan myös kantaa yritysten käyttämiin monenlaisiin testaus-tasoihin, -tyyppeihin ja testauksessa kohdattuihin haasteisiin. Tämä opinnäyte perustuu testausprosessistandardeihin. Ohjelmistotestausstandardit ovat keskeisessä asemassa tässä työssä, vaikka ne ovat olleet viime aikoina vahvan kritiikin kohteena. Epäilys standardien välttämättömyyteen on syntynyt muutoksista ohjelmistokehityksessä. Tämä työ esittelee tulokset ohjelmistotestauksen käytännöistä. Tuloksia on verrattu aiheeseen liittyvän aiemman kyselyn (Lee, Kang, & Lee, 2011) tuloksiin. Ajanpuutteen havaitaan olevan suuri haaste ohjelmistotestauksessa. Ketterä ohjelmistokehitys on saavuttanut suosiota kaikissa vastaajien yrityksissä. Testauksen menetelmät ja työkalut testauksen arviointiin, suunnitteluun ja raportointiin ovat hyvin vähäisessä käytössä. Toisaalta testauksen menetelmien ja työkalujen käyttö automaattiseen testauksen toteuttamiseen ja virheiden hallintaan on lisääntynyt. Järjestelmä-, hyväksyntä-, yksikkö- ja integraatiotestaus ovat käytössä kaikkien vastaajien edustamissa yrityksissä. Kaikkien vastaajien mielestä regressio- sekä tutkiva- ja ei-funktionaalinen testaus ovat tärkeitä tekniikoita.

Reconstruction of cranial bone defects with fiber-reinforced composite–bioactive glass implants

A cranial bone defect may result after an operative treatment of trauma, infection, vascular insult, or tumor. New biomaterials for cranial bone defect reconstructions are needed for example to mimic the biomechanical properties and structure of cranial bone. A novel glass fiber-reinforced composite implant with bioactive glass particulates (FRC–BG, fiber-reinforced composite–bioactive glass) has osteointegrative potential in a preclinical setting. The aim of the first and second study was to investigate the functionality of a FRC–BG implant in the reconstruction of cranial bone defects. During the years 2007–2014, a prospective clinical trial was conducted in two tertiary level academic institutions (Turku University Hospital and Oulu University Hospital) to evaluate the treatment outcome in 35 patients that underwent a FRC–BG cranioplasty. The treatment outcome was good both in adult and pediatric patients. A number of conventional complications related to cranioplasty were observed. In the third study, a retrospective outcome evaluation of 100 cranioplasty procedures performed in Turku University Hospital between years 2002–2012 was conducted. The experimental fourth study was conducted to test the load-bearing capacity and fracture behavior of FRC–BG implants under static loading. The interconnective bars in the implant structure markedly increased the load-bearing capacity of the implant. A loading test did not demonstrate any protrusions of glass fibers or fiber cut. The fracture type was buckling and delamination. In this study, a postoperative complication requiring a reoperation or removal of the cranioplasty material was observed in one out of five cranioplasty patients. The treatment outcomes of cranioplasty performed with different synthetic materials did not show significant difference when compared with autograft. The FRC–BG implant was demonstrated to be safe and biocompatible biomaterial for large cranial bone defect reconstructions in adult and pediatric patients.

Quality indicators and shelf life of red octopus (Octopus maya) in chilling storage

Abstract There are no precedents concerning the quality of Octopus maya during chilled storage. This study evaluated the shelf life of the red octopus in chilling storage (4oC) and the correlation of the sensory quality index with microbiological counting and the biochemical indicators (hypoxanthine, histamine and volatile amines). A total of 112 whole raw octopi (average weight of 896 g) were randomly selected from seven batches and exposed to 4°C for 18, 24, 48, 72, 84, 96, and 100 h. The histamine concentration (91.7%), followed by the counts of psychrotrophic bacteria (5.5%) and hypoxanthine (2.2%), were the predictors from the redundancy analysis that better explained the changes taking place during the chilling hours. After 72 h of chilling, the microbial count was determined to be log 4.7 CFU/g, and the octopus samples were classified as B quality (minor sensory quality defects) based on the sensory quality scale. Although the samples were not classified as unacceptable at 100 h of refrigeration by the sensory index, the level of histamine reached the defect action level (5 mg/100 g) as ruled by the International Food Safety Authorities. The shelf life of the red octopus in chilling storage was predicted to be 119 h.

Genetics of inherited small vessel diseases – in search of a novel small vessel disease and modifiers of the clinical course of CADASIL

The genetic and environmental risk factors of vascular cognitive impairment are still largely unknown. This thesis aimed to assess the genetic background of two clinically similar familial small vessel diseases (SVD), CADASIL (Cerebral Autosomal Dominant Arteriopathy with Subcortical Infarcts and Leukoencephalopathy) and Swedish hMID (hereditary multi-infarct dementia of Swedish type). In the first study, selected genetic modifiers of CADASIL were studied in a homogenous Finnish CADASIL population of 134 patients, all carrying the p.Arg133Cys mutation in NOTCH3. Apolipoprotein E (APOE) genotypes, angiotensinogen (AGT) p.Met268Thr polymorphism and eight NOTCH3 polymorphisms were studied, but no associations between any particular genetic variant and first-ever stroke or migraine were seen. In the second study, smoking, statin medication and physical activity were suggested to be the most profound environmental differences among the monozygotic twins with CADASIL. Swedish hMID was for long misdiagnosed as CADASIL. In the third study, the CADASIL diagnosis in the Swedish hMID family was ruled out on the basis of genetic, radiological and pathological findings, and Swedish hMID was suggested to represent a novel SVD. In the fourth study, the gene defect of Swedish hMID was then sought using whole exome sequencing paired with a linkage analysis. The strongest candidate for the pathogenic mutation was a 3’UTR variant in the COL4A1 gene, but further studies are needed to confirm its functionality. This study provided new information about the genetic background of two inherited SVDs. Profound knowledge about the pathogenic mutations causing familial SVD is also important for correct diagnosis and treatment options.