Pontos polêmicos acerca do forrageamento de cupins subterrâneos (Isoptera: Rhinotermitidae): consumo de alimentos similares, reutilização de iscas e tunelamento em solos não uniformes

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Monopólio canavieiro e produção de alimentos

Estudou-se a concentração de terra em torno da cana-de-açúcar como produto exportação e a conseqüente redução da produção de aumentos básicos de consumo interno. Foi escolhido para o estudo o Município de Dumont, da microrregião homogênea de Ribeirão Preto, Estado de São Paulo. A pesquisa foi conduzida com base nos Censos Agropecuários de 1960, 1970 e 1980. A implantação do PROÁLCOOL acelerou a expansão da cana, que ocupa mais de 65% das terras do município.

Repensando a produção e distribuição de alimentos no Brasil

Neste estudo são analisadas algumas questões relacionadas à produção e distribuição dos alimentos no Brasil. A partir desta análise evidencia-se a existência de relações complexas entre os vários momentos do processo econômico, bem como a dominação exercida pelo capital industrial e/ou comercial sobre os pequenos agricultores. Os instrumentos de política agrícola exercem, principalmente através dos mecanismos de crédito, um papel relevante nessa condição de dominação.

Avaliação da presença de Toxoplasma gondii em quibes crus e em carnes suína e bovina comercializadas em Botucatu-SP

Pós-graduação em Medicina Veterinária - FMVZ

Caracterização higiênico-sanitária de restaurantes comerciais do município de Botucatu-São Paulo

Pós-graduação em Medicina Veterinária - FMVZ

Ação antibacteriana de associações de antimicrobianos: nisina, óleos essenciais e compostos majotitários

Pós-graduação em Biologia Geral e Aplicada - IBB

Dispositivo para controle da contaminação microbiana dos fluidos de corte com utilização de baixa temperatura

A presente patente diz respeito a um dispositivo de refrigeração de fluidos de corte interligado em máquinas de usinagem, retificadoras e/ou de corte, visando reduzir a contaminação microbiana dos fluidos de corte, oferecendo, paralelamente, maior poder de refrigeração sobre a peça e a ferramenta de corte, composto por caixa de resfriamento (2) com serpentina em banho de gelo ou um refrigerador de líquidos (2A), depósito do fluido (3), sendo que a caixa de resfriamento e o depósito de fluido são revestidos com material isolante térmico (4) e devidamente interligados por tubos (5).

Dispositivo para controle da contaminação microbiana dos fluidos de corte com utilização de radiação ultravioleta

A presente patente diz respeito a um dispositivo usado para reduzir a contaminação microbian dos fluidos de corte através de raios ultravioletas, o qual c nsiste em um tampo metálico que se adapta ao reservatório (3) de fluido de corte fechando completamente sua face superior, cujo tampo (1) contém lâmpadas (2) ultravioletas germicidas (UV-C), dispostas lado a lado, apresentando, ainda, pequenas janel s (4) para observação dispostas lateralmente e interruptor (5) ara as lâmpadas (2), sendo que os reatores das lâmpadas (2) s o instalados sobre uma chapa metálica (6).

Processo de destilação para redução de contaminação por carbamato de etila em bebidas alcoólicas

Contamination of Brazilian sugar-cane rum by ethyl carbamate, a potentially carcinogenic substance, is considered an obstacle to export of the beverage. Copper is involved in ethyl-carbamate-formation reactions, and the replacement thereof by stainless steel in distillation equipment, with the aim of preventing the formation of said compound, results in a beverage of poor sensory quality owing to the presence of dimethyl sulphide. A reduction in the concentration of sulphurated compounds in the final product may be achieved by the placing of a copper device (Patent No. 8206688) inside the dome of a stainless-steel alembic. It is therefore appropriate to verify the efficiency of using other forms of catalysts that, in addition to reducing ethyl-carbamate levels, are able, likewise, to trigger other catalytic actions that allow the production of a distillate of good sensory quality. Silver is the noble metal most used in industry and, on account of the catalytic properties thereof, it is ideal for use as a catalyst in oxidation reactions. The subject matter of the present invention comprises a method involving the use of silver in the distillation of alcoholic beverages, such as sugar-cane rum, which reduces ethyl-carbamate contamination of the end-product.

NaOCl effect on biofilm produced by Staphylococcus aureus isolated from the milking environment and mastitis infected cows

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Contaminação por fungos antes e após limpeza e desinfecção de colchões hospitalares

OBJECTIVE: To verify the existence of fungal contamination prior to and following the cleaning and disinfection process of hospital mattresses used by patients with Candidemia. METHODS: Cross-sectional study analyzing 25 mattresses used by patients with Candidemia confirmed by blood culture from different hospital wards. The study made use of convenience samples. After growing the samples in an Agar Sabouraud Dextrose environment, isolated yeasts were identified by macroscopic, microscopic and physiologic characteristics. RESULTS: Analyses showed 15 (60%) mattresses contaminated by Candida spp. From these, 10 (66.7%) and five (33.3%) mattresses corresponded respectively to the collection prior to and following disinfection, with Candida parapsilosis being the isolated species with the highest frequency. CONCLUSION: Considering that half of the mattresses remained contaminated after cleaning and disinfection, there is a risk that these mattresses may act as potential secondary reservoirs in the infection chain.

Programa de Aquisição de Alimentos: limites e potencialidades de políticas de segurança alimentar para a agricultura familiar

The Programa de Aquisição de Alimentos was created by the Lula administration (2003) as part of Fome Zero (Zero Hungry). This program aims to ensure access to food for people living in food and/or nutritional insecure situation and strengthen family agriculture, by food that is pushased by the government. Considering the importance of this program as a differentiated policy that we abode in the analysis far of its implementation on national scale, as its operationalization in a specific context, with the spatial cutout of the municipality Dracena, located on São Paulo state western portion. It was found that, either in national and municipal levels, the program presented a growth on the number of approved projects, participating producers, benefited institutions and resource values. However, even with such expansion, the scope of this program is still quite limited and at the same time, too concentrated in spatial terms.

PCR fluorescente associada à eletroforese capilar como ferramenta de diagnóstico de bactérias no semen

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

Infecção por Fusarium graminearum e Fusarium verticillioides em sementes de milho

The previous knowledge of the infection process and pathogens behavior, for evaluating the physiological potential of maize seeds, is essential for decision making on the final destination of lots that can endanger sowing. This research was carried out in order to study the minimum period required for maize seeds contamination by Fusarium graminearum Schwabe and Fusarium verticillioides (Sacc.) Nirenberg, as well as these pathogens influence on seed germination and vigor, by using the cold test. Three maize seeds hybrids, kept in contact with the pathogens for different periods, were evaluated with and without surface disinfection. After determining the most suitable period, new samples were contaminated by F. graminearum and F. verticillioides, under different infection levels, and subjected to germination tests in sand. The cold test was conducted with healthy and contaminated seeds, at different periods, in a cold chamber. The contact of maize seeds with F. graminearum and F. verticillioides for 16 hours was enough to cause infection. F. graminearum and F. verticillioides did not affect the maize seeds germination, however, F. graminearum reduced the vigor of seeds lots.