Robust Mixture Modelling Using the t Distribution

Normal mixture models are being increasingly used to model the distributions of a wide variety of random phenomena and to cluster sets of continuous multivariate data. However, for a set of data containing a group or groups of observations with longer than normal tails or atypical observations, the use of normal components may unduly affect the fit of the mixture model. In this paper, we consider a more robust approach by modelling the data by a mixture of t distributions. The use of the ECM algorithm to fit this t mixture model is described and examples of its use are given in the context of clustering multivariate data in the presence of atypical observations in the form of background noise.

Incomplete, asymmetric, and route-dependent cross-tolerance between oxycodone and morphine in the Dark Agouti rat

Our previous studies indicate that oxycodone is a putative kappa-opioid agonist, whereas morphine is a well documented mu-opioid agonist. Because there is limited information regarding the development of tolerance to oxycodone, this study was designed to 1) document the development of tolerance to the antinociceptive effects of chronically infused i.v. oxycodone relative to that for i.v. morphine and 2) quantify the degree of antinociceptive cross-tolerance between morphine and oxycodone in adult male Dark Agouti (DA) rats. Antinociceptive testing was performed using the tail-flick latency test. Complete antinociceptive tolerance was achieved in 48 to 84 h after chronic infusion of equi-antinociceptive doses of i.v. oxycodone (2.5 mg/24 h and 5 mg/24 h) and i.v. morphine (10 mg/24 h and 20 mg/24 h, respectively). Dose-response curves for bolus doses of i.v. and i.c.v. morphine and oxycodone were produced in naive, morphine-tolerant, and oxycodone-tolerant rats. Consistent with our previous findings that oxycodone and morphine produce their intrinsic antinociceptive effects through distinctly different opioid receptor populations, there was no discernible cross-tolerance when i.c.v. oxycodone was given to morphine-tolerant rats. Similarly, only a low degree of cross-tolerance (approximate to 24%) was observed after i.v. oxycodone administration to morphine-tolerant rats. By contrast, both i.v. and i.c.v. morphine showed a high degree of cross-tolerance (approximate to 71% and approximate to 54%, respectively) in rats rendered tolerant to oxycodone. Taken together, these findings suggest that, after parenteral but not supraspinal administration, oxycodone is metabolized to a mu-opioid agonist metabolite, thereby explaining asymmetric and incomplete cross-tolerance between oxycodone and morphine.

Soil carbon determination by high temperature combustion - A comparison with dichromate oxidation procedures and the influence of charcoal and carbonate carbon on the measured value

The measurement of organic carbon in soils has traditionally used dichromate oxidation procedures including the Wakley and Black and the Heanes methods. The measurement of carbon in soils by high temperature combustion is now widely used providing a rapid automated procedure without the use of toxic chemicals. This procedure however measures total carbon thus requiring some means of correction for soil samples containing carbonate and charcoal forms of carbon. This paper examines the effects of known additions of charcoal to a range of soil types on the results obtained by the Walkley and Black, Heanes and combustion methods. The results show, that while the charcoal carbon does not react under Walkley and Black conditions, some proportion does so with the Heanes method. A comparison of six Australian Soil and Plant Analysis Council reference soil samples by the three methods showed good agreement between the Heanes method, the combustion method and only slightly lower recoveries by the Walkley and Black procedure. Carbonate carbon will cause an overestimation of soil organic carbon by the combustion method thus requiring a separate determination of carbonate carbon to be applied as a correction. This work shows that a suitable acid pre-treatment of alkaline soils in the sample boats followed by a drying step eliminates the carbonate carbon prior to combustion and the need for an additional measurement. The measurement of carbon in soils by high temperature combustion in an oxygen atmosphere has been shown to be a rapid and reliable method capable of producing results in good agreement with one of the established dichromate oxidation procedures.

Opposite roles of O-2 in NO- and N2O-carbon reactions: An ab initio study

Previous experimental studies showed that the presence of O-2 greatly enhances NO-carbon reaction while it depresses N2O-carbon reaction on carbon surfaces. A popular explanation for the rate increase is that the addition of O-2 results in a large number of reactive carbon-oxygen complexes, and decomposition of these complexes produces many more active sites. The explanation for the latter is that excess O-2 simply blocks the active sites, thus reducing the rate of N2O-carbon reaction. The contradiction is that O-2 can also occupy active sites in NO-carbon reaction and produce active sites in N2O-carbon reduction. By using ab initio calculation, we find that the opposite roles of O-2 are caused by the different manners of N2O and NO adsorption on the carbon surface. In the presence of excess O-2, most Of the active sites are occupied by oxygen groups. In the competition for the remaining active sites, NO is more likely to chemisorb in the form of NO2 and NO chemisorption is mon thermodynamically favorable than O-2 chemisorption. By contrast, the presence of excess O-2 makes N2O chemisorption much less thermally stable either on the consecutive edge sites or edge sites isolated by semiquinone oxygen. A detailed analysis and discussion of the reaction mechanism of N-2 formation from NO- and N2O-carbon reaction in the presence of O-2 is presented in this paper.

Modelling solute transport in structured soils: Performance evaluation of the ADR and TRM models

The movement of chemicals through the soil to the groundwater or discharged to surface waters represents a degradation of these resources. In many cases, serious human and stock health implications are associated with this form of pollution. The chemicals of interest include nutrients, pesticides, salts, and industrial wastes. Recent studies have shown that current models and methods do not adequately describe the leaching of nutrients through soil, often underestimating the risk of groundwater contamination by surface-applied chemicals, and overestimating the concentration of resident solutes. This inaccuracy results primarily from ignoring soil structure and nonequilibrium between soil constituents, water, and solutes. A multiple sample percolation system (MSPS), consisting of 25 individual collection wells, was constructed to study the effects of localized soil heterogeneities on the transport of nutrients (NO3-, Cl-, PO43-) in the vadose zone of an agricultural soil predominantly dominated by clay. Very significant variations in drainage patterns across a small spatial scale were observed tone-way ANOVA, p < 0.001) indicating considerable heterogeneity in water flow patterns and nutrient leaching. Using data collected from the multiple sample percolation experiments, this paper compares the performance of two mathematical models for predicting solute transport, the advective-dispersion model with a reaction term (ADR), and a two-region preferential flow model (TRM) suitable for modelling nonequilibrium transport. These results have implications for modelling solute transport and predicting nutrient loading on a larger scale. (C) 2001 Elsevier Science Ltd. All rights reserved.

Examining the influence of biological and psychological factors on cognitive performance in chronic fatigue syndrome: A randomized, double-blind, placebo-controlled, crossover study

The pathophysiology of chronic fatigue syndrome (CFS) remains unclear; however, both biological and psychological factors have been implicated in establishing or maintaining this condition. People with CFS report significant and disabling cognitive difficulties such as impaired concentration that in some cases are exacerbated by exposure to chemical triggers. The aim of this study was to determine if neuropsychological deficits in CFS are triggered by exposure to chemicals, or perceptions about the properties of these substances. Participants were 36 people with a primary diagnosis of CFS, defined according to Centers for Disease Control (CDC) criteria. A randomized, double-blind, placebo-controlled, crossover design was used, with objective assessment of neuropsychological function and participant rating of substance type, before and after exposure to placebo or chemical trigger. Results showed decrements in neuropsychological tests scores on three out of four outcome measures when participants rated the substance they had been exposed to as chemical. No change in performance was found based on actual substance type. These results suggest that cognitive attributions about exposure substances in people with CFS may be associated with worse performance on neuropsychological tasks. In addition, these findings suggest that psychological interventions aimed at modifying substance-related cognitions may reduce some symptoms of CFS.

Proteasomal degradation of N-acetyltransferase 1 is prevented by acetylation of the active site cysteine - A mechanism for the slow acetylator phenotype and substrate-dependent down-regulation

Many drugs and chemicals found in the environment are either detoxified by N-acetyltransferase 1 (NAT1, EC 2.3.1.5) and eliminated from the body or bioactivated to metabolites that have the potential to cause toxicity and/or cancer. NAT1 activity in the body is regulated by genetic polymorphisms as well as environmental factors such as substrate-dependent down-regulation and oxidative stress. Here we report the molecular mechanism for the low protein expression from mutant NAT1 alleles that gives rise to the slow acetylator phenotype and show that a similar process accounts for enzyme down-regulation by NAT1 substrates. NAT1 allozymes NAT1 14, NAT1 15, NAT1 17, and NAT1 22 are devoid of enzyme activity and have short intracellular half-lives (similar to4 h) compared with wild-type NAT1 4 and the active allozyme NAT1 24. The inactive allozymes are unable to be acetylated by cofactor, resulting in ubiquitination and rapid degradation by the 26 S proteasome. This was confirmed by site-directed mutagenesis of the active site cysteine 68. The NAT1 substrate p-aminobenzoic acid induced ubiquitination of the usually stable NAT1 4, leading to its rapid degradation. From this study, we conclude that NAT1 exists in the cell in either a stable acetylated state or an unstable non-acetylated state and that mutations in the NAT1 gene that prevent protein acetylation produce a slow acetylator phenotype.

Mandibular gland secretions of meliponine worker bees: further evidence for their role in interspecific and intraspecific defence and aggression and against their role in food source signalling

Like ants and termites some species of stingless bees (Meliponini), which are very important pollinators in the tropics, use pheromone trails to communicate the location of a food source. We present data on the communicative role of mandibular gland secretions of Meliponini that resolve a recent controversy about their importance in the laying of such trails. Volatile constituents of the mandibular glands have been erroneously thought both to elicit aggressive/defensive behaviour and to signal food source location. We studied Trigona spinipes and Scaptotrigona aff. depilis (`postica`), two sympatric species to which this hypothesis was applied. Using extracts of carefully dissected glands instead of crude cephalic extracts we analysed the substances contained in the mandibular glands of worker bees. Major components of the extracts were 2-heptanol (both species), nonanal (T. spinipes), benzaldehyde and 2-tridecanone (S. aff. depilis). The effect of mandibular gland extracts and of individual components thereof on the behaviour of worker bees near their nest and at highly profitable food sources was consistent. Independent of the amount of mandibular gland extract applied, the bees overwhelmingly reacted with defensive behaviour and were never attracted to feeders scented with mandibular gland extract or any of the synthetic chemicals tested. Both bee species are capable of using mandibular gland secretions for intra-and interspecific communication of defence and aggression and share 2-heptanol as a major pheromone compound. While confirming the role of the mandibular glands in nest defence, our experiments provide strong evidence against their role in food source signalling.

Residues of spinosad in the tissues of sheep after aerosol treatment of blowfly myiasis

Objective To measure the residues of spinosad and chlorhexidine in the tissues of sheep after treatment of blowfly strike. Procedure Fourteen sheep with natural myiasis and 12 with artificial infestations of Lucilia cuprina larvae had the wool removed over their infestations and were treated with an aerosol wound dressing containing spinosad and chlorhexidine. Sheep were killed up to 14 days after treatment and residues of the chemicals measured in tissues. Results Chlorhexidine was not detected in any tissue. Residues of spinosad were highest in fat, lowest in muscle and intermediate in liver and kidney. The highest residue detected was 0.2 mg/kg spinosad in perirenal fat 7 days after generous treatment of a sheep with a large fly strike. Residues of spinosad in fat peaked 3 to 7 days after treatment and 1 to 3 days after treatment in liver and kidney. Conclusion These studies present a realistic worst-case in struck sheep and at the highest dose studied, equivalent to 5.8 mg spinosad per kg body weight, the maximum residue detected of 0.2 mg/kg in peri-renal fat was 20% of the Australian maximum residue limit. Muscle, liver and kidney residues of spinosad were also below the Australian maximum residue limits at all times.

Experience-induced preference for oviposition repellents derived from a non-host plant by a specialist herbivore

Foraging adults of phytophagous insects are attracted by host-plant volatiles and supposedly repelled by volatiles from non-host plants. In behavioural control of pest insects, chemicals derived from non-host plants applied to crops are expected to repel searching adults and thereby reduce egg laying. How experience by searching adults of non-host volatiles affects their subsequent searching and oviposition behaviour has been rarely tested. In laboratory experiments, we examined the effect of experience of a non-host-plant extract on the oviposition behaviour of the diamondback moth (DBM), Plutella xylostella, a specialist herbivore of cruciferous plants. Naive ovipositing DBM females were repelled by an extract of dried leaves of Chrysanthemum morifolium, a non-host plant of DBM, but experienced females were not repelled. Instead they were attracted by host plants treated with the non-host-plant extract and laid a higher proportion of eggs on treated than on untreated host plants. Such behavioural changes induced by experience could lead to host-plant range expansion in phytophagous insects and play an important role in determining outcome for pest management of some behavioural manipulation methods.

Immunopathology of allergic contact dermatitis

Allergic contact dermatitis is the consequence of an immune reaction mediated by T cells against low molecular weight chemicals known as haptens. It is a common condition that occurs in all races and age groups and affects the quality of life of those who present it. The immunological mechanism of this disease has been reviewed in recent decades with significant advance in its understanding. The metabolism and pathway of the haptens as well as the activation and mechanism of action of the cells responsible for both the immune reaction and its completion are discussed in this article.

Three-dimensional model for multi-component reactive transport with variable density groundwater flow

PHWAT is a new model that couples a geochemical reaction model (PHREEQC-2) with a density-dependent groundwater flow and solute transport model (SEAWAT) using the split-operator approach. PHWAT was developed to simulate multi-component reactive transport in variable density groundwater flow. Fluid density in PHWAT depends not on only the concentration of a single species as in SEAWAT, but also the concentrations of other dissolved chemicals that can be subject to reactive processes. Simulation results of PHWAT and PHREEQC-2 were compared in their predictions of effluent concentration from a column experiment. Both models produced identical results, showing that PHWAT has correctly coupled the sub-packages. PHWAT was then applied to the simulation of a tank experiment in which seawater intrusion was accompanied by cation exchange. The density dependence of the intrusion and the snow-plough effect in the breakthrough curves were reflected in the model simulations, which were in good agreement with the measured breakthrough data. Comparison simulations that, in turn, excluded density effects and reactions allowed us to quantify the marked effect of ignoring these processes. Next, we explored numerical issues involved in the practical application of PHWAT using the example of a dense plume flowing into a tank containing fresh water. It was shown that PHWAT could model physically unstable flow and that numerical instabilities were suppressed. Physical instability developed in the model in accordance with the increase of the modified Rayleigh number for density-dependent flow, in agreement with previous research. (c) 2004 Elsevier Ltd. All rights reserved.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Drugs in the acute porphyrias - Toxicogenetic diseases

The acute Porphyrias are examples of toxico-genetic diseases and diseases genetically acquired, which show an idiosyncratic reaction to certain chemicals and drugs. Porphyrics are at risk of developing an acute attack if exposed to various precipitating factors of which drugs are the most common factor. This paper presents lists of drugs complied into those hazardous for patients with acute porphyria and those thought to be safe.