ß-Spectrin São PauloII, a novel frameshift mutation of the ß-spectrin gene associated with hereditary spherocytosis and instability of the mutant mRNA

Hereditary spherocytosis (HS) is a common inherited anemia characterized by the presence of spherocytic red cells. Defects in several membrane protein genes have been involved in the pathogenesis of HS. ß-Spectrin-related HS seems to be common. We report here a new mutation in the ß-spectrin gene coding region in a patient with hereditary spherocytosis. The patient presented acanthocytosis and spectrin deficiency and, at the DNA level, a novel frameshift mutation leading to HS, i.e., a C deletion at codon 1392 (ß-spectrin São PauloII), exon 20. The mRNA encoding ß-spectrin São PauloII was very unstable and the mutant protein was not detected in the membrane or in other cellular compartments. It is interesting to note that frameshift mutations of the ß-spectrin gene at the 3' end allow the insertion of the mutant protein in the red cell membrane, leading to a defect in the auto-association of the spectrin dimers and consequent elliptocytosis. On the other hand, ß-spectrin São PauloII protein was absent in the red cell membrane, leading to spectrin deficiency, HS and the presence of acanthocytes.

Spectroscopic Studies of III-V Semiconductor Materials for Improved Devices

Defects in semiconductor crystals and at their interfaces usually impair the properties and the performance of devices. These defects include, for example, vacancies (i.e., missing crystal atoms), interstitials (i.e., extra atoms between the host crystal sites), and impurities such as oxygen atoms. The defects can decrease (i) the rate of the radiative electron transition from the conduction band to the valence band, (ii) the amount of charge carriers, and (iii) the mobility of the electrons in the conduction band. It is a common situation that the presence of crystal defects can be readily concluded as a decrease in the luminescence intensity or in the current flow for example. However, the identification of the harmful defects is not straightforward at all because it is challenging to characterize local defects with atomic resolution and identification. Such atomic-scale knowledge is however essential to find methods for reducing the amount of defects in energy-efficient semiconductor devices. The defects formed in thin interface layers of semiconductors are particularly difficult to characterize due to their buried and amorphous structures. Characterization methods which are sensitive to defects often require well-defined samples with long range order. Photoelectron spectroscopy (PES) combined with photoluminescence (PL) or electrical measurements is a potential approach to elucidate the structure and defects of the interface. It is essential to combine the PES with complementary measurements of similar samples to relate the PES changes to changes in the interface defect density. Understanding of the nature of defects related to III-V materials is relevant to developing for example field-effect transistors which include a III-V channel, but research is still far from complete. In this thesis, PES measurements are utilized in studies of various III-V compound semiconductor materials. PES is combined with photoluminescence measurements to study the SiO2/GaAs, SiNx/GaAs and BaO/GaAs interfaces. Also the formation of novel materials InN and photoluminescent GaAs nanoparticles are studied. Finally, the formation of Ga interstitial defects in GaAsN is elucidated by combining calculational results with PES measurements.

Congenital upper limb defects in Finland 1993-2005

Background: Interest in limb defects has grown after the thalidomide tragedy in the 1960s. As a result, congenital malformation registries, monitoring changes in birthprevalence and defect patterns, have been established in several countries. However, there are only a few true population based studies on birth prevalence of upper limb defects. The burden of hospital care among these children, specifically in terms of the number of admissions and total time spent in hospital, is also unknown. Aims and Methods: This study is based on information gathered from the Finnish Register of Congenital malformations (FRM) and the Finnish Hospital Discharge Register (FHDR). A total of 417 children born between 1993 and 2005 with an upper limb defect were gathered from the FRM. The upper limb defects were classified using the International Federation of Societies for Surgery of the Hand -classification that enables comparison with previous and future studies. Birth and live birth prevalence, sex and side distribution, frequency of associated anomalies as well as the proportion of perinatal and infant deaths according to the different subtypes were calculated. The number of hospital admissions, days spent in hospital, number and type of surgical operations were collected from the FHDR. Special features of two subgroups, radial ray defects (RRD) and constriction band syndrome (CBS), were explored. Results: Upper limb defects were observed in 417 of 753 342 consecutive births and in 392 of 750 461 live births. Birth prevalence was 5.5 per 10 000 births and 5.2 per 10 000 live births. Multiple anomalies or a known syndrome was found in 250 cases (60%). Perinatal mortality was 139 per 1000 births and infant mortality 135 per 1000 live births (overall Finnish perinatal mortality <5 per 1000 births and infant mortality 3.7 per 1000 live births). Altogether, 138 infants had RRD and 120 (87%) of these had either a known syndrome or multiple major anomalies. The proportion of perinatal deaths in RRD group was 29% (40/138) and infant deaths 35% (43/123). Fifty-one children had CBS in upper limbs. Fifteen of these (29%) had other major anomalies associated with constriction rings. The number of hospital admissions per year of children with congenital upper limb defects was 11-fold and the time spent in hospital 13-fold as compared with the general paediatric population. Conclusions: Birth prevalence of congenital upper limb defects was 5.5 per 10 000 births and 5.2 per 10 000 live births. RRD was especially associated with other major anomalies and high mortality. Nearly one third of the children with CBS also had other major anomalies suggesting different aetiologies inside the group. The annual burden of hospital care of children with congenital upper limb defects was at least 11-fold as compared with the general paediatric population.

Diagnosis of Smith-Lemli-Opitz syndrome by ultraviolet spectrophotometry

Smith-Lemli-Opitz syndrome (SLOS) is an autosomal recessive disorder due to an inborn error of cholesterol metabolism, characterized by congenital malformations, dysmorphism of multiple organs, mental retardation and delayed neuropsychomotor development resulting from cholesterol biosynthesis deficiency. A defect in 3ß-hydroxysteroid-delta7-reductase (delta7-sterol-reductase), responsible for the conversion of 7-dehydrocholesterol (7-DHC) to cholesterol, causes an increase in 7-DHC and frequently reduces plasma cholesterol levels. The clinical diagnosis of SLOS cannot always be conclusive because of the remarkable variability of clinical expression of the disorder. Thus, confirmation by the measurement of plasma 7-DHC levels is needed. In the present study, we used a simple, fast, and selective method based on ultraviolet spectrophotometry to measure 7-DHC in order to diagnose SLOS. 7-DHC was extracted serially from 200 µl plasma with ethanol and n-hexane and the absorbance at 234 and 282 nm was determined. The method was applied to negative control plasma samples from 23 normal individuals and from 6 cases of suspected SLOS. The method was adequate and reliable and 2 SLOS cases were diagnosed.

Evaluation of stunned and infarcted canine myocardium by real time myocardial contrast echocardiography

Differentiation between stunned and infarcted myocardium in the setting of acute ischemia is challenging. Real time myocardial contrast echocardiography allows the simultaneous assessment of myocardial perfusion and function. In the present study we evaluated infarcted and stunned myocardium in an experimental model using real time myocardial contrast echocardiography. Sixteen dogs underwent 180 min of coronary occlusion followed by reperfusion (infarct model) and seven other dogs were submitted to 20 min of coronary occlusion followed by reperfusion (stunned model). Wall motion abnormality and perfusional myocardial defect areas were measured by planimetry. Risk and infarct areas were determined by tissue staining. In the infarct model, the wall motion abnormality area during coronary occlusion (5.52 ± 1.14 cm²) was larger than the perfusional myocardial defect area (3.71 ± 1.45 cm²; P < 0.001). Reperfusion resulted in maintenance of wall motion abnormality (5.45 ± 1.41 cm²; P = 0.43 versus occlusion) and reduction of perfusional myocardial defect (1.51 ± 1.29 cm²; P = 0.004 versus occlusion). Infarct size determined by contrast echocardiography correlated with tissue staining (r = 0.71; P = 0.002). In the stunned model, the wall motion abnormality area was 5.49 ± 0.68 cm² during occlusion and remained 5.1 ± 0.63 cm² after reperfusion (P = 0.07). Perfusional defect area was 2.43 ± 0.79 cm² during occlusion and was reduced to 0.2 ± 0.53 cm² after reperfusion (P = 0.04). 2,3,5-Triphenyl tetrazolium chloride staining confirmed the absence of necrotic myocardium in all dogs in the stunned model. Real time myocardial contrast echocardiography is a noninvasive technique capable of distinguishing between stunned and infarcted myocardium after acute ischemia.

Normal expression of IFN-gammaR in four patients with uncommon mycobacterial infection phenotypes

Several primary immunodeficiency diseases affecting the interleukin 12/interferon gamma (IFN-gamma) pathway have been identified, most of them characterized by recurrent and protracted infections produced by intracellular microorganisms, particularly by several species of mycobacteria. In the present study we analyzed the expression of IFN-gamma receptor (IFN-gammaR) and signal transducer and activator of transcription 1 (STAT-1) in 4 children with Mycobacterium tuberculosis infection of uncommon clinical presentation. These molecules were evaluated by flow cytometry and Western blotting in B cells transformed with Epstein-Barr virus and mutations were scanned by single-strand conformational polymorphisms and DNA sequencing. The expression of IFN-gammaR1 was normal in all 4 patients. The genetic analysis of IFN-gammaR1 and IFN-gammaR2 coding sequences did not reveal any mutation. The expression of the STAT-1 molecule was similar in patients and healthy controls; however, when the phosphorylation of this transcription factor in response to IFN-gamma activation was evaluated by Western blot, a significant lower signal was evident in one patient. These data indicate that there are no alterations in the expression or function of the IFN-gammaR chains in these patients. However, the low level of STAT-1 phosphorylation found in one of these patients might be explained by a defect in one of the molecules involved in the signal transduction pathway after IFN-gamma interacts with its receptor. In the other three patients the inability to eliminate the mycobacteria may be due to a defect in another effector mechanism of the mononuclear phagocytes.

Effects of metformin treatment on luteal phase progesterone concentration in polycystic ovary syndrome

The causes of luteal phase progesterone deficiency in polycystic ovary syndrome (PCOS) are not known. To determine the possible involvement of hyperinsulinemia in luteal phase progesterone deficiency in women with PCOS, we examined the relationship between progesterone, luteinizing hormone (LH) and insulin during the luteal phase and studied the effect of metformin on luteal progesterone levels in PCOS. Patients with PCOS (19 women aged 18-35 years) were treated with metformin (500 mg three times daily) for 4 weeks prior to the test cycle and throughout the study period, and submitted to ovulation induction with clomiphene citrate. Blood samples were collected from control (N = 5, same age range as PCOS women) and PCOS women during the late follicular (one sample) and luteal (3 samples) phases and LH, insulin and progesterone concentrations were determined. Results were analyzed by one-way analysis of variance (ANOVA), Duncan's test and Karl Pearson's coefficient of correlation (r). The endocrine study showed low progesterone level (4.9 ng/ml) during luteal phase in the PCOS women as compared with control (21.6 ng/ml). A significant negative correlation was observed between insulin and progesterone (r = -0.60; P < 0.01) and between progesterone and LH (r = -0.56; P < 0.05) concentrations, and a positive correlation (r = 0.83; P < 0.001) was observed between LH and insulin. The study further demonstrated a significant enhancement in luteal progesterone concentration (16.97 ng/ml) in PCOS women treated with metformin. The results suggest that hyperinsulinemia/insulin resistance may be responsible for low progesterone levels during the luteal phase in PCOS. The luteal progesterone level may be enhanced in PCOS by decreasing insulin secretion with metformin.

Congenital ventricular septal defects and prenatal exposure to cyclooxygenase inhibitors

Ventricular septal defects (VSDs) are common congenital abnormalities which have been reported to be associated with maternal fever and various environmental factors. The aim of the present study was to evaluate the effect of prenatal exposure to cyclooxygenase (COX) inhibitors on heart defects. A retrospective statistical analysis was performed using data collected in our laboratory during various teratological studies carried out on albino CRL:(WI)WUBR Wistar strain rats from 1997 to 2004. The observations were compared with concurrent and historic control data, as well as findings from other developmental toxicological studies with selective and nonselective COX-2 inhibitors. Despite the lack of significant differences in the frequency of VSDs between drug-exposed and control groups, statistical analysis by the two-sided Mantel-Haenszel test and historical control data showed a higher incidence of heart defects in offspring exposed to nonselective COX inhibitors (30.06/10,000). Unlike other specific inhibitors, aspirin (46.26/10,000) and ibuprofen (106.95/10,000) significantly increased the incidence of the VSD when compared with various control groups (5.38-19.72/10,000). No significant differences in length or weight were detected between fetuses exposed to COX inhibitors and born with VSD and non-malformed offsprings. However, a statistically significant increase of fetal body length and decrease of body mass index were found in fetuses exposed to COX inhibitors when compared with untreated control. We conclude that prenatal exposure to COX inhibitors, especially aspirin and ibuprofen, increased the incidence of VSDs in rat offspring but was not related to fetal growth retardation.

Elevated amniotic fluid amino acid levels in fetuses with gastroschisis

Our objective was to measure maternal plasma and amniotic fluid amino acid concentrations in pregnant women diagnosed as having fetuses with gastroschisis in the second trimester of pregnancy. Twenty-one pregnant women who had fetuses with gastroschisis detected by ultrasonography (gastroschisis group) in the second trimester and 32 women who had abnormal triple screenings indicating an increased risk for Down syndrome but had healthy fetuses (control group) were enrolled in the study. Amniotic fluid was obtained by amniocentesis, and maternal plasma samples were taken simultaneously. The chromosomal analysis of the study and control groups was normal. Levels of free amino acids and non-essential amino acids were measured in plasma and amniotic fluid samples using EZ:fast kits (EZ:fast GC/FID free (physiological) amino acid kit) by gas chromatography (Focus GC AI 3000 Thermo Finnigan analyzer). The mean levels of essential amino acids (histidine, isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan, and valine) and non-essential amino acids (alanine, glycine, proline, and tyrosine) in amniotic fluid were found to be significantly higher in fetuses with gastroschisis than in the control group (P < 0.05). A significant positive correlation between maternal plasma and amniotic fluid concentrations of essential and nonessential amino acids was found only in the gastroschisis group (P < 0.05). The detection of significantly higher amino acid concentrations in the amniotic fluid of fetuses with a gastroschisis defect than in healthy fetuses suggests the occurrence of amino acid malabsorption or of amino acid leakage from the fetus into amniotic fluid.

Immunoglobulin production is impaired in protein-deprived mice and can be restored by dietary protein supplementation

Most contacts with food protein and microbiota antigens occur at the level of the gut mucosa. In animal models where this natural stimulation is absent, such as germ-free and antigen-free mice, the gut-associated lymphoid tissue (GALT) and systemic immunological activities are underdeveloped. We have shown that food proteins play a critical role in the full development of the immune system. C57BL/6 mice weaned to a diet in which intact proteins are replaced by equivalent amounts of amino acids (Aa diet) have a poorly developed GALT as well as low levels of serum immunoglobulins (total Ig, IgG, and IgA, but not IgM). In the present study, we evaluated whether the introduction of a protein-containing diet in 10 adult Aa-fed C57BL/6 mice could restore their immunoglobulin levels and whether this recovery was dependent on the amount of dietary protein. After the introduction of a casein-containing diet, Aa-fed mice presented a fast recovery (after 7 days) of secretory IgA (from 0.33 to 0.75 mg/mL, while in casein-fed mice this value was 0.81 mg/mL) and serum immunoglobulin levels (from 5.39 to 10.25 mg/mL of total Ig). Five percent dietary casein was enough to promote the restoration of secretory IgA and serum immunoglobulin levels to a normal range after 30 days feeding casein diet (as in casein-fed mice - 15% by weight of diet). These data suggest that the defect detected in the immunoglobulin levels was a reversible result of the absence of food proteins as an antigenic stimulus. They also indicate that the deleterious consequences of malnutrition at an early age for some immune functions may be restored by therapeutic intervention later in life.

Transient high-level expression of ß-galactosidase after transfection of fibroblasts from GM1 gangliosidosis patients with plasmid DNA

GM1 gangliosidosis is an autosomal recessive disorder caused by the deficiency of lysosomal acid hydrolase ß-galactosidase (ß-Gal). It is one of the most frequent lysosomal storage disorders in Brazil, with an estimated frequency of 1:17,000. The enzyme is secreted and can be captured by deficient cells and targeted to the lysosomes. There is no effective treatment for GM1 gangliosidosis. To determine the efficiency of an expression vector for correcting the genetic defect of GM1 gangliosidosis, we tested transfer of the ß-Gal gene (Glb1) to fibroblasts in culture using liposomes. ß-Gal cDNA was cloned into the expression vectors pSCTOP and pREP9. Transfection was performed using 4 µL lipofectamine 2000 and 1.5-2.0 µg DNA. Cells (2 x 10(5)/well) were harvested 24 h, 48 h, and 7 days after transfection. Enzyme specific activity was measured in cell lysate and supernatant by fluorometric assay. Twenty-four hours after transfection, treated cells showed a higher enzyme specific activity (pREP9-ß-Gal: 621.5 ± 323.0, pSCTOP-ß-Gal: 714.5 ± 349.5, pREP9-ß-Gal + pSCTOP-ß-Gal: 1859.0 ± 182.4, and pREP9-ß-Gal + pTRACER: 979.5 ± 254.9 nmol·h-1·mg-1 protein) compared to untreated cells (18.0 ± 3.1 for cell and 32.2 ± 22.2 nmol·h-1·mg-1 protein for supernatant). However, cells maintained in culture for 7 days showed values similar to those of untreated patients. In the present study, we were able to transfect primary patients' skin fibroblasts in culture using a non-viral vector which overexpresses the ß-Gal gene for 24 h. This is the first attempt to correct fibroblasts from patients with GM1 gangliosidosis by gene therapy using a non-viral vector.

Oculo-facio-cardio-dental syndrome in three succeeding generations: genotypic data and phenotypic features

Oculo-facio-cardio-dental (OFCD) syndrome is a rare X-linked disorder mainly manifesting in females. Patients show ocular, facial, cardiac, and dental abnormalities. OFCD syndrome is caused by heterozygous mutations in the BCOR gene, located in Xp11.4, encoding the BCL6 co-repressor. We report a Croatian family with four female members (grandmother, mother and monozygotic female twins) diagnosed with OFCD syndrome who carry the novel BCOR mutation c.4438C>T (p.R1480*). They present high intrafamilial phenotypic variability with special regard to cardiac defect and cataract that showed more severe disease expression in successive generations. Clinical and radiographic examination of the mother of the twins revealed a talon cusp involving the permanent maxillary right central incisor. This is the first known report of a talon cusp in OFCD syndrome with a novel mutation in the BCOR gene.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

MFG-E8, a clearance glycoprotein of apoptotic cells, as a new marker of disease severity in chronic obstructive pulmonary disease

Milk fat globule epidermal growth factor 8 (MFG-E8) is an opsonin involved in the phagocytosis of apoptotic cells. In patients with chronic obstructive pulmonary disease (COPD), apoptotic cell clearance is defective. However, whether aberrant MFG-E8 expression is involved in this defect is unknown. In this study, we examined the expression of MFG-E8 in COPD patients. MFG-E8, interleukin (IL)-1β and transforming growth factor (TGF)-β levels were measured in the plasma of 96 COPD patients (93 males, 3 females; age range: 62.12±10.39) and 87 age-matched healthy controls (85 males, 2 females; age range: 64.81±10.11 years) using an enzyme-linked immunosorbent assay. Compared with controls, COPD patients had a significantly lower plasma MFG-E8 levels (P<0.01) and significantly higher plasma TGF-β levels (P=0.002), whereas there was no difference in plasma IL-1β levels between the two groups. Moreover, plasma MFG-E8 levels decreased progressively between Global Initiative for Chronic Obstructive Lung Disease (GOLD) I and GOLD IV stage COPD. Multiple regression analysis showed that the forced expiratory volume in 1 s (FEV1 % predicted) and smoking habit were powerful predictors of MFG-E8 in COPD (P<0.01 and P=0.026, respectively). MFG-E8 was positively associated with the FEV1 % predicted and negatively associated with smoking habit. The area under the receiver operating characteristic curve was 0.874 (95% confidence interval: 0.798-0.95; P<0.01). Our findings demonstrated the utility of MFG-E8 as a marker of disease severity in COPD and that cigarette smoke impaired MFG-E8 expression in these patients.

Concentração de suco de laranja (Citrus sinensis) por osmose inversa

A concentração de suco de laranja por osmose inversa combinada com ultrafiltração foi estudada em escala semi-piloto, visando avaliar a utilização dessa tecnologia para substituição parcial da evaporação. Foram utilizados no processamento 100 litros de suco de laranja, com teor de polpa de 1,5%, cedidos pela CTM Citrus. Na primeira etapa, todo o suco passou pela etapa de ultrafiltração, para separação da polpa, enzimas pectinolíticas e microrganismos, que foram retidos. Foi utilizada uma membrana da Romicom (HF-43) de polissulfona em um sistema de configuração tubular, com peso molecular de corte de 50.000 daltons, à pressão de 1,2 bar. Obteve-se um fator de concentração de 27,6. O retentado da ultrafiltração foi pasteurizado à temperatura de 90°C, em trocador de calor de superfície raspada desenvolvido para este projeto. O processo de osmose inversa foi conduzido no equipamento Lab-unit M-20 da DDS, utilizando membranas da DDS (HR 95 PP) de filme composto em um sistema de configuração quadro e placas. Foram realizados três tratamentos com pressões de 20, 40 e 60 bar e para cada experimento, foram feitas três repetições. O retentado pasteurizado da ultrafiltração foi adicionado ao retentado da osmose inversa e caracterizado química, física e sensorialmente. Na osmose inversa foram obtidos fatores de concentração de 2,7, 3,5 e 3,6 e teores de sólidos solúveis de 18, 23 e 30 °Brix, para os tratamentos de 20, 40 e 60 bar, respectivamente. Os respectivos permeados apresentaram teores de sólidos solúveis de 3,3, 1,3 e 0,3°Brix e acidez de 262,50, 91,50 e 34,25 mg de ácido cítrico/100 ml. Os sucos obtidos pelos três tratamentos apresentaram valores de "defect score" e "color score" superiores aos do suco original, enquanto que para o "flavor score", os sucos obtidos às pressões de 40 e 60 bar, apresentaram valores próximos ao ideal. Os valores de "ratio", pH e formol foram semelhantes entre os tratamentos. O teor de óleo foi maior no tratamento realizado à menor pressão enquanto que o teor de vitamina C foi maior no de maior pressão. Tanto o suco concentrado quanto o diluído, nos três tratamentos, foram caracterizados como fluidos Newtonianos, apresentando valores de viscosidade maiores quando obtidos a maiores pressões.