Comparative toxicity of antifouling compounds on the development of sea urchin

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Acurácia dos índices antropométricos de obesidade central na determinação de síndrome metabólica e fatores de risco cardiovascular em mulheres com síndrome dos ovários policísticos

A síndrome dos ovários policísticos (SOP) é a desordem endócrina mais comum em mulheres com idade reprodutiva. Seu diagnóstico é firmado através do consenso de Rotterdam na presença de dois dos seguintes critérios: anovulação crônica, sinais clínicos e/ou bioquímicos de hiperandrogenismo e presença de micropolicistos nos ovários. Na SOP, além das características específicas da síndrome é comum a presença de marcadores de risco cardiovascular aumentado como dislipidemia, hipertensão arterial, resistência à insulina e obesidade central Objetivos: Analisar a acurácia diagnóstica da circunferência da cintura (CC), relação cintura-estatura (RCEst), razão cintura-quadril (RCQ) e índice de conicidade (Índice C) para detecção de fatores de risco cardiovascular (FRCV) e síndrome metabólica (SM) em mulheres com síndrome dos ovários policísticos (SOP). Metodologia: Foi realizado estudo transversal envolvendo 108 mulheres na faixa etária de 20-34 anos, com diagnóstico de SOP de acordo com o consenso de Rotterdam. Foram considerados parâmetros clínicos, antropométricos e bioquímicos de avaliação do risco cardiovascular. A análise dos dados foi desenvolvida em duas etapas, conforme descrito a seguir. Fase 1: análise da acurácia dos pontos de corte previamente determinados na literatura nacional para CC, RCEst, RCQ e Índice C, para predição de FRCV; Fase 2: determinação de pontos de corte dos índices antropométricos supracitados, específicos para mulheres com SOP, para discriminação de SM, através da análise da curva ROC (Receiver Operating Characteristic). Resultados: Com base nos achados da fase 1 do estudo, a RCEst foi o marcador que apresentou correlações positivas significativas com o xi maior número de FRCV (pressão arterial, triglicerídeos e glicemia após teste oral de tolerância à glicose), além de correlação negativa com HDL-colesterol. Os demais marcadores antropométricos se correlacionaram positivamente com pressão arterial, enquanto CC e RCQ apresentaram correlação positiva também com triglicerídeos. Todos os indicadores antropométricos apresentaram taxas de sensibilidade superiores a 60%, com destaque para a RCEst que apresentou sensibilidade superior a 70%. Na fase 2 da pesquisa observamos que a CC, RCEst e RCQ apresentaram desempenho semelhante na predição de SM, sendo superiores ao Índice C. Os valores de ponto de corte dos índices antropométricos para discriminar SM foram: CC = 95 cm; RCEst = 0,59; RCQ = 0,88; e Índice C = 1,25. Utilizando esses pontos de corte as taxas de sensibilidade e especificidade da CC e RCEst foram superiores às observadas para RCQ e Índice C. Conclusões: Nossos dados enfatizam a importância da avaliação antropométrica no rastreamento do risco cardiovascular em mulheres com SOP, destacando-se a relevância da RCEst na predição de FRCV clássicos e a necessidade de considerar pontos de corte específicos para mulheres com SOP para discriminação de SM

Activity of sesame leaf extracts against the symbiotic fungus of Atta sexdens L.

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Avaliação in vitro e in vivo da Atividade Antioxidante do Extrato Hidroetanólico de Folhas de Turnera ulmifolia Linn. var. elegans (Turneraceae)

Recently, it has been a increasing interest in the antioxidative role of natural products to aid the endogenous protective biological systems against the deleterious effects of oxygen (ROS) and nitrogen (RNS) reactive species. Many antioxidant compounds, naturally occurring from plant sources. Natural antioxidants can protect and prevent the human body from oxidative stress and retard the progress of many diseases in which free radical are involved. Several plants used in the folk medicine to treat certain disorders that are accompanied by inflammation and other pharmacological properties have been proved their attributed properties, such antioxidant activity. Turnera ulmifolia Linn. var. elegans (Turneraceae), frequently employed by population as a medicinal plant, demonstrated antioxidant activity by in vitro and in vivo assays, using its leaf hydroethanolic extract (10%) he in vitro DPPH radical-scanvenging activity showed a strong antioxidant activity (86.57% ± 0.14), similar to Carduus marianus and catequine effects. For the in vivo assays, adult female Wistar rats (n=48) with carbon tetrachloride hepatic injury induced (2,5mL/kg i.p.) were used, Six groups or rats were uses (n=8) [G1 = control (1,25 mL/kg i.p. vehicle); G2 = CCl4 (2,5 mL/kg i.p.); G3 = CCl4 + extract 7 days (500 mg/kg p.o.); G4 = CCl4 + Legalon® 7 days (50 mg/kg p.o.), G5 = CCl4 + extract 21 days (500 mg/kg p.o.) e G6 = CCl4 + Legalon® 21 days (50 mg/kg p.o.)]. The hepatic oxidative injury was evaluated through biochemical parameters [alanine amino transferase (ALT), aspartate amino transferase (AST)] histopathological study, while thiobarbituric acid reactive products (TBAR), glutathione (GSH), catalase (CAT), superoxide dismutase (SOD), and glutathione peroxidase (GPx) levels were used to evaluate proantioxidant parameters. The plant extract tested was found effective as hepatoprotective as evidenced by a decreasing in the ALT and AST activities (p<0.001) and TBAR (plasma, p<0.001 and liver, p<0.001). Levels of GSH (blood, p<0.001 and liver, p<0.001) and antioxidant enzymes [CAT erythrocyte (p<0.05) and hepatic (p<0.01); SOD erythrocyte (p<0.001) and hepatic (p<0.001); GPx erythrocyte (p<0.001) and hepatic (p<0.001)] were also significantly increased. Histopathological changes induced by CCl4 were significantly reduced by the extract treatment. The data obtained were comparable to that of Legalon®, a reference hepatoprotective drug. The results showed that T. ulmifolia leaf extract protects against CCl4 induced oxidative damage. Therefore, this effect must be associated to its antioxidant activity, attributed to the phenolic compounds, present in these extract, which can act as free radical scavengers

Evaluation of fungicide applications to sweet orange at different flowering stages for control of postbloom fruit drop caused by Colletotrichum acutatum

Postbloom fruit drop (PFD), caused by Colletotrichum acutatum, produces blossom blight, fruit abscission and persistent calyces. in groves of Pera-Rio and Natal sweet orange located in Santa Cruz do Rio Pardo and Rincao, São Paulo, Brazil, four experiments were carried out to evaluate the effectiveness of fungicides sprayed alone or as mixtures, at different flowering stages for the control of PFD of citrus. The number of symptomatic flowers, the percentage of fruit set (FS), and the relationship between persistent calyces and total fruit weight per plant were evaluated. The fungicides carbendazim and folpet were sprayed at 0.50 ml and 1.25 ga.i. l(-1) of water, respectively, were superior by all the criteria to the other treatments. Carbendazim and folpet fungicides performed best when they were applied at the green bud through hollow ball stages. Difenoconazole, independent of application timing, was less effective by all criteria used. Application of mancozeb at 1.60 ga.i. l(-1) at the green bud stage followed by application of mancozeb in a tank mix with carbendazim or folpet at 1.0 ml and 1.25 g a.i. l(-1), respectively, during green bud bloom and hollow ball stages were effective for disease control. Carbendazim combined with 0.25% KNO3, reduced the number of persistent calyces and increased fruit production significantly. Applications must be made between green bud and hollow ball stages for best control. Applications only at hollow ball or open flower stages did not provide effective disease control. (C)2007 Elsevier Ltd. All rights reserved.

Relação predador: presa de Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) para o controle do pulgão-verde em genótipos de sorgo

O uso da resistência de plantas associado a agentes de controle biológico pode ser uma alternativa viável no controle de Schizaphis graminum (Rondani) em sorgo. Objetivou-se estudar diferentes relações predador:presa em genótipos de sorgo resistente (TX 430 x GR 111), moderadamente resistente (GB 3B) e suscetível (BR 007B) para o controle do pulgão-verde por Chrysoperla externa (Hagen). Para isso foram realizadas, em condições de casa-de-vegetação, liberações do crisopídeo nas relações predador:presa de 1:5; 1:10; 1:25 e 1:50. O genótipo TX 430 x GR 111 foi o mais eficiente no controle do pulgão-verde, S. graminum, assim como as relações predador:presa de 1:5 e de 1:10 nos três genótipos. A interação resistência de plantas e controle biológico foi positiva e permitiu controle acima de 80% nas relações predador:presa de 1:5 e 1:10 no material resistente TX 430 x GR 111; no genótipo GB 3B o melhor controle foi obtido com 1 predador: 5 presas.

First isolation and molecular characterization of Toxoplasma gondii from finishing pigs from São Paulo State, Brazil

Toxoplasma gondii infection is widely prevalent in humans in Brazil. Among the food animals, pigs are considered the most important meat source of T. gondii for infection in humans. In the present study, we report the first isolation of viable T. gondii from finishing pigs in Brazil. Antibodies to T. gondii were found in 49 (17%) of 286 pigs prior slaughter using the modified agglutination test (MAT) at a serum dilution of 1:25. Attempts were made to isolate T. gondii from 28 seropositive pigs. Samples of heart, brain, and tongue from each pig were pooled, digested in acid pepsin, and bioassayed in five mice per pig. Viable T. gondii was isolated from seven pigs; all isolates were lethal for mice. Restriction fragment length polymorphism on products of SAG2 locus amplified by PCR revealed that two isolates were Type I and five were Type III. The results indicate that phenotypically and genetically T. gondii isolates from pigs from Brazil are distinct from isolates of T gondii from pigs in the USA. (c) 2005 Elsevier B.V. All rights reserved.

Calagem e diagnose foliar em sorgo sacarino (Sorghum bicolor L. moench)

Os efeitos da aplicação de cinco níveis de calcário dolomítico (0 - 1,25 - 2,50-5,00 e 10,00 t/ha) foram estudados em um Latossol Vermelho Escuro textura média. A calagem aumentou a produção de colmos de sorgo sacarino, sendo que as produções mais elevadas foram obtidas quando a soma de cálcio e magnésio, saturação em bases e valor pH do solo eram, respectivamente, 2,93 meq/100 cm³, 59% e 5,71. Foram observados desequilíbrios na nutrição potássica com a aplicação de 10 t/ha de calcário dolomítico. Os níveis críticos de Mg nas folhas + 4e + 3, coletadas, respectivamente, aos 45e 83 dias, foram 0,19 e 0,31% A qualidade do caldo não foi alterada significativamente pelas doses de calcário dolomítico empregadas.

In vitro acaricidal activity of neem (Azadirachta indica) seed extracts with known azadirachtin concentrations against Rhipicephalus microplus

The effect of four extracts from neem seeds (Azadirachta indica) containing 2000, 5000, 9000 and 10,000 ppm of azadirachtin A (AZA), quantified by high-performance liquid chromatography (HPLC) and diluted to 1.25%; 2.5%; 5.0%; 10.0% and 12.8% was verified by in vitro tests with engorged females and larvae of the cattle tick Rhipicephalus micro plus. The results from the bioassays with the engorged females showed that the main toxic effect of the extracts was reduction of the reproductive parameters, with a sharp drop in the number of eggs laid and the hatching rate, mainly when the extracts were diluted to 10.0% and 12.8%. The product effectiveness (PE) calculations for all the solutions tested showed that the AZA solution at 10,000 ppm (N10) was the most effective. However, statistical analysis of the PE data obtained for the proportional AZA concentrations in the different diluted extracts showed significance (P<0.05) of the effects included in the model (extract dilution, principle effect (classificatory) of the assay (extract) and the interaction between the two), indicating significant variations due to the dilution, the test and the interaction between the two factors in the tests with engorged females. For solutions N2, N5, and N9, it was not possible to estimate LC(90) values in the dilution range tested. The lowest LC(50) was observed for extract N5, and although extract N10 was the only extract for which the LC(90) could be estimated within the range tested, the LC(50) was higher than for N5 and N9. These results suggest that substances other than AZA present in the extracts influenced the efficacy, especially up to a certain LC range. In the tests with larvae, no mortality was observed, indicating zero effectiveness of all the extracts tested. The results of the tests with engorged females showed that the neem extracts had acaricide activity, inhibiting egg laying and the larval hatching rate. Complementary studies are necessary to develop new methods to isolate and/or identify other substances besides AZA contained in this plant, to enable using products made from it as acaricides. (C) 2011 Elsevier B.V. All rights reserved.

Sistema radicular e nutrição da soja em função da compactação do solo

A compactação do solo diminui o crescimento radicular, podendo afetar tanto o desenvolvimento quanto a produtividade da soja. No presente trabalho, estudaram-se os efeitos da compactação subsuperficial na morfologia radicular da soja (Glycine max L. Merrill), procurando relacioná-los ao crescimento e à nutrição da planta. O 'Primavera' foi cultivado até os 37 dias da emergência, em vasos onde a camada de 15-18,5 cm de profundidade foi campactada a 1,03, 1,25, 1,48 e 1,72 g/cm³, em um latossolo vermelho-escuro com 80% de areia e 16% de argila e cuja compactação em subsuperfície levou a um acúmulo de raízes na camada superficial do vaso, sem grandes conseqüências na nutrição da planta. Na densidade aparente de 1,72 g/cm3, as raízes não conseguiram penetrar, embora já houvesse alguma restrição ao crescimento na densidade de 1,25 g/cm³. Quando a camada compactada apresentava resistência à penetração de 0,69 MPa, houve uma redução de 50% no crescimento radicular da soja.

Seletividade de herbicidas aplicados em pré-emergência na cultura de cana-de-açúcar tratada com nematicidas

O objetivo do trabalho foi estudar a seletividade de herbicidas para a cultura da cana-de-açúcar quando aplicado em culturas tratadas com nematicidas. O experimento foi instalado em área pertencente à Usina São José, município de Borebi-SP, ano agrícola de 2000/01. A variedade de cana-de-açúcar utilizada foi a RB855113. Utilizou-se o delineamento experimental de blocos ao acaso em parcelas subdivididas, com quatro repetições. Cada parcela correspondeu a 27 linhas de 10,0 m, espaçadas em 1,0 m, sendo dividida em três subparcelas. As parcelas corresponderam aos tratamentos com os herbicidas, e as subparcelas, à aplicação ou não dos nematicidas carbofuran (2,10 kg ha-1) e terbufós 2,25 kg ha¹). Os herbicidas testados foram: tebuthiuron (1,12 kg ha-1), ametryne (1,75 kg ha¹), sulfentrazone (0,8 kg ha-1), metribuzin (1,92 kg ha-1), isoxaflutole (0,0525 kg ha¹), clomazone (1,25 kg ha¹), oxyfluorfen (0,36 kg ha-1) e azafenidin+hexazinone (0,1575 + 0,2025 kg ha-1), sendo todos aplicados em pré-emergência, além de uma parcela como testemunha. Os resultados obtidos evidenciaram que os herbicidas oxyfluorfen e azafenidin+hexazinone causaram os maiores níveis de fitotoxicidade na cana-de-açúcar, independentemente do uso dos nematicidas carbofuran e terbufós. Os herbicidas tebuthiuron, ametryne, sulfentrazone, metribuzin, isoxaflutole, clomazone, oxyfluorfen e azafenidin+hexazinone, aplicados em doses representativas das comercialmente utilizadas, mostraram-se seletivos à cana-de-açúcar, não afetando seu crescimento, sua produtividade e suas características tecnológicas. Os nematicidas não interferiram nos níveis de intoxicação provocados pelos herbicidas utilizados na cultura.

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Produção de quitosanase por aspergillus ochraceus em cultivo descontínuo submerso

In this work a 24 factorial design with triplicate at central point was used in order to investigate the influence of chitosan concentration (substrate) (Cs), culture media temperature (CMT), aeration ratio (AR) as well as agitation (A) on chitosanase production by Aspergillus ochraceus. Experiments were carried out using the following levels to the factors: (Cs) (-1) 0.1%; (0) 0.15%; (+1) 0.2%; (TMC) (-1) 25 minutes; (0) 30 minutes; (+1) 35 minutes; (RA) (-1) 0.4; (0) 0.6; (+1) 0.8; (A) (-1) 90 rpm, (0) 120 rpm, (+1) 150 rpm. One chitosanolytic activity (U.mL-1) was defined as the enzyme necessary to produce 1.0 mmol.min-1 of glicosamine by mL of extract. Chitosanolytic assays were carried out using two extract volumes, 0.05 and 0.1 mL, respectively. Results showed that was possible to produce chitosanase of order aproximatelly 5,9 U.mL-1 by Aspergillus ochraceus and chitosanolytic activity was increased by increment on substrate concentration, aeration ratio as well as agitation while media culture temperature increment decreased activity

Efeitos de fungicidas sobre os aspectos biológicos de Aphis gossypii Glover, 1877 (Hemiptera: Aphididae) em plantas de pepino

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Avaliação do processo oxidativo avançado por permanganato de potássio no tratamento de solos contaminados com idrocarbonetos poliaromáticos

The soil contamination with petroleum is one of the major concern of industries operating in the field and also of environmental agencies. The petroleum consists mainly of alkanes and aromatic hydrocarbons. The most common examples of hydrocarbons polyaromatic are: naphthalene, anthracene, phenanthrene, benzopyrene and their various isomers. These substances cause adverse effects on human and the environment. Thus, the main objective of this work is to study the advanced oxidation process using the oxidant potassium permanganate (KMnO4) for remediation of soils contaminated with two polyaromatic hydrocarbons (PAHs): anthracene and phenanthrene. This study was conducted at bench scale, where the first stage was at batch experiment, using the variables: the time and oxidant dosage in the soil. The second stage was the remediation conducted in continous by a fix column, to this stage, the only variable was remediation time. The concentration of oxidant in this stage was based on the best result obtained in the tests at batch, 2,464 mg / L. The results of degradation these contaminants were satisfactory, at the following dosages and time: (a) 5g of oxidant per kg soil for 48 hours, it was obtained residual contaminants 28 mg phenanthrene and 1.25 mg anthracene per kg of soil and (b) for 7g of oxidant per kg soil in 48 hours remaining 24 mg phenanthrene and anthracene 0.77 mg per kg soil, and therefore below the intervention limit residential and industrial proposed by the State Company of Environmental Sao Paulo (CETESB)