987 resultados para simple loop
Resumo:
The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.
Resumo:
A new quadrifilar antenna has been developed for generating circularly polarized backfire radiation. The antenna consists of two orthogonal rectangular conducting loops, each incorporating capacitive coupling and fed using either a single or two coaxial cables. Though the geometry is much simpler than a conventional quadrifilar helix antenna, the radiation pattern performance is very similar. Measured and simulated patterns are compared for two antennas with different feed arrangements. It is shown that the resonant structure can produce a cardioid pattern with a directivity of 4.5 dB (120 3-dB beamwidth) and a front-to-back ratio of more than 20 dB at the center operating frequency. A 10% impedance bandwidth (VSWR
Resumo:
The Solar Eclipse Corona Imaging System (SECIS) was used to record high-cadence observations of the solar corona during the total solar eclipse of 1999 August 11. During the 2 min 23.5 s of totality, 6364 images were recorded simultaneously in each of the two channels: a white light channel, and the Fe xiv (5303 Angstrom) 'green line' channel (T similar to2 MK). Here we report initial results from the SECIS experiment, including the discovery of a 6-s intensity oscillation in an active region coronal loop.
Resumo:
Simple electron capture processes are studied using an orthonormal two state continuum-distorted-wave (CDW) basis. The suitability of the basis set is tested by comparing predictions for total and differential cross sections with available experimental data. Overall good agreement is obtained and the authors conclude that a relatively small CDW basis set may be suitable to model a wide variety of low-energy collisions if the members of this extended set are astutely chosen.
Resumo:
Structural and thermodynamic properties of spherical particles carrying classical spins are investigated by Monte Carlo simulations. The potential energy is the sum of short range, purely repulsive pair contributions, and spin-spin interactions. These last are of the dipole-dipole form, with however, a crucial change of sign. At low density and high temperature the system is a homogeneous fluid of weakly interacting particles and short range spin correlations. With decreasing temperature particles condense into an equilibrium population of free floating vesicles. The comparison with the electrostatic case, giving rise to predominantly one-dimensional aggregates under similar conditions, is discussed. In both cases condensation is a continuous transformation, provided the isotropic part of the interatomic potential is purely repulsive. At low temperature the model allows us to investigate thermal and mechanical properties of membranes. At intermediate temperatures it provides a simple model to investigate equilibrium polymerization in a system giving rise to predominantly two-dimensional aggregates.
Resumo:
In this paper we study a simple model potential energy surface (PES) useful for describing multiple proton translocation mechanisms. The approach presented is relevant to the study of more complex biomolecular systems like enzymes. In this model, at low temperatures, proton tunnelling favours a concerted proton transport mechanism, while at higher temperatures there is a crossover from concerted to stepwise mechanisms; the crossover temperature depends on the energetic features of the PES. We illustrate these ideas by calculating the crossover temperature using energies taken from ab initio calculations on specific systems. Interestingly, typical crossover temperatures lie around room temperature; thus both concerted and stepwise reaction mechanisms should play an important role in biological systems, and one can be easily turned into another by external means such as modifying the temperature or the pH, thus establishing a general mechanism for modulation of the biomolecular function by external effectors.
Resumo:
A total energy tight-binding model with a basis of just one s state per atom is introduced. It is argued that this simplest of all tight-binding models provides a surprisingly good description of the structural stability and elastic constants of noble metals. By assuming inverse power scaling laws for the hopping integrals and the repulsive pair potential, it is shown that the density matrix in a perfect primitive crystal is independent of volume, and structural energy differences and equations of state are then derived analytically. The model is most likely to be of use when one wishes to consider explicitly and self-consistently the electronic and atomic structures of a generic metallic system, with the minium of computation expense. The relationship to the free-electron jellium model is described. The applicability of the model to other metals is also considered briefly.
Resumo:
A number of routes to hydroxyiminodehydroquinate, one of the most potent inhibitors of type II dehydroquinase that is currently known, have been investigated. Methods based on the existing literature synthesis, i.e. oxime formation of a suitably C-4 and C-5 protected methyl 3-dehydroquinate derivative were initially studied. Benzoyl protection did give the desired product but in low overall yield. An alternative BBA protection strategy starting with a protected dehydroquinate was successful in generating a C4/C5 analogue of the desired oxime in high yield. Further investigation revealed that it was unecessary to protect the dehydroquinate precursor, hence the potassium salt corresponding to the desired oxime was simply synthesised as a single isomer from methyl dehydroquinate.