988 resultados para neutron zerfall MAC-E-Filter CKM-Matrix
                                
Resumo:
In this paper we report the observation of drifts in the responsivity of cryogenically cooled InSb detector-based infrared filter radiometers which have very strong wavelength dependence. These drifts can result in the increase or decrease of the response of the filter radiometers by over 5%. The origin of these variations was investigated and was shown to arise due to a thin film of ice formed on the multi-layer bandpass filter used to define the spectral response of the filter radiometer. The thin layer of ice interacts with the characteristics of the filter (which itself consists of a number of thin layers) and modifies the filter spectral transmission thus modifying the response of the filter radiometer of which the filter is part of. These observations are particularly relevant to space instruments which use infrared filter radiometers for earth observation. Debris from the spacecraft engines is known to accumulate on cold surfaces of instruments carried on board. The deposition of this debris on cold filters can modify the spectral response of the instruments, which use these filters to define a spectral response. Crown Copyright (c) 2004 Published by Elsevier B.V. All rights reserved.
                                
Resumo:
Ashby was a keen observer of the world around him, as per his technological and psychiatrical developments. Over the years, he drew numerous philosophical conclusions on the nature of human intelligence and the operation of the brain, on artificial intelligence and the thinking ability of computers and even on science in general. In this paper, the quite profound philosophy espoused by Ashby is considered as a whole, in particular in terms of its relationship with the world as it stands now and even in terms of scientific predictions of where things might lead. A meaningful comparison is made between Ashby's comments and the science fiction concept of 'The Matrix' and serious consideration is given as to how much Ashby's ideas lay open the possibility of the matrix becoming a real world eventuality.
                                
Resumo:
In this paper we consider bilinear forms of matrix polynomials and show that these polynomials can be used to construct solutions for the problems of solving systems of linear algebraic equations, matrix inversion and finding extremal eigenvalues. An almost Optimal Monte Carlo (MAO) algorithm for computing bilinear forms of matrix polynomials is presented. Results for the computational costs of a balanced algorithm for computing the bilinear form of a matrix power is presented, i.e., an algorithm for which probability and systematic errors are of the same order, and this is compared with the computational cost for a corresponding deterministic method.
                                
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
                                
                                
Resumo:
We present a novel approach to calculating Low-Energy Electron Diffraction (LEED) intensities for ordered molecular adsorbates. First, the intra-molecular multiple scattering is computed to obtain a non-diagonal molecular T-matrix. This is then used to represent the entire molecule as a single scattering object in a conventional LEED calculation, where the Layer Doubling technique is applied to assemble the different layers, including the molecular ones. A detailed comparison with conventional layer-type LEED calculations is provided to ascertain the accuracy of this scheme of calculation. Advantages of this scheme for problems involving ordered arrays of molecules adsorbed on surfaces are discussed.
                                
Resumo:
A new man-made target tracking algorithm integrating features from (Forward Looking InfraRed) image sequence is presented based on particle filter. Firstly, a multiscale fractal feature is used to enhance targets in FLIR images. Secondly, the gray space feature is defined by Bhattacharyya distance between intensity histograms of the reference target and a sample target from MFF (Multi-scale Fractal Feature) image. Thirdly, the motion feature is obtained by differencing between two MFF images. Fourthly, a fusion coefficient can be automatically obtained by online feature selection method for features integrating based on fuzzy logic. Finally, a particle filtering framework is developed to fulfill the target tracking. Experimental results have shown that the proposed algorithm can accurately track weak or small man-made target in FLIR images with complicated background. The algorithm is effective, robust and satisfied to real time tracking.
                                
Resumo:
Dense deployments of wireless local area networks (WLANs) are becoming a norm in many cities around the world. However, increased interference and traffic demands can severely limit the aggregate throughput achievable unless an effective channel assignment scheme is used. In this work, a simple and effective distributed channel assignment (DCA) scheme is proposed. It is shown that in order to maximise throughput, each access point (AP) simply chooses the channel with the minimum number of active neighbour nodes (i.e. nodes associated with neighbouring APs that have packets to send). However, application of such a scheme to practice depends critically on its ability to estimate the number of neighbour nodes in each channel, for which no practical estimator has been proposed before. In view of this, an extended Kalman filter (EKF) estimator and an estimate of the number of nodes by AP are proposed. These not only provide fast and accurate estimates but can also exploit channel switching information of neighbouring APs. Extensive packet level simulation results show that the proposed minimum neighbour and EKF estimator (MINEK) scheme is highly scalable and can provide significant throughput improvement over other channel assignment schemes.
                                
Resumo:
We present extensive molecular dynamics simulations of the dynamics of diluted long probe chains entangled with a matrix of shorter chains. The chain lengths of both components are above the entanglement strand length, and the ratio of their lengths is varied over a wide range to cover the crossover from the chain reptation regime to tube Rouse motion regime of the long probe chains. Reducing the matrix chain length results in a faster decay of the dynamic structure factor of the probe chains, in good agreement with recent neutron spin echo experiments. The diffusion of the long chains, measured by the mean square displacements of the monomers and the centers of mass of the chains, demonstrates a systematic speed-up relative to the pure reptation behavior expected for monodisperse melts of sufficiently long polymers. On the other hand, the diffusion of the matrix chains is only weakly perturbed by the diluted long probe chains. The simulation results are qualitatively consistent with the theoretical predictions based on constraint release Rouse model, but a detailed comparison reveals the existence of a broad distribution of the disentanglement rates, which is partly confirmed by an analysis of the packing and diffusion of the matrix chains in the tube region of the probe chains. A coarse-grained simulation model based on the tube Rouse motion model with incorporation of the probability distribution of the tube segment jump rates is developed and shows results qualitatively consistent with the fine scale molecular dynamics simulations. However, we observe a breakdown in the tube Rouse model when the short chain length is decreased to around N-S = 80, which is roughly 3.5 times the entanglement spacing N-e(P) = 23. The location of this transition may be sensitive to the chain bending potential used in our simulations.
                                
Resumo:
This paper reports on the design and manufacture of an ultra-wide (5-30µm) infrared edge filter for use in FTIR studies of the low frequency vibrational modes of metallo-proteins. We present details of the spectral design and manufacture of such a filter which meets the demanding bandwidth and transparency requirements of the application, and spectra that present the new data possible with such a filter. A design model of the filter and the materials used in its construction has been developed capable of accurately predicting spectral performance at both 300K and at the reduced operating temperature at 200K. This design model is based on the optical and semiconductor properties of a multilayer filter containing PbTe (IV-VI) layer material in combination with the dielectric dispersion of ZnSe (II-VI) deposited on a CdTe (II-VI) substrate together with the use of BaF2 (II-VII) as an antireflection layer. Comparisons between the computed spectral performance of the model and spectral measurements from manufactured coatings over a wavelength range of 4-30µm and temperature range 300-200K are presented. Finally we present the results of the FTIR measurements of Photosystem II showing the improvement in signal to noise ratio of the measurement due to using the filter, together with a light induced FTIR difference spectrum of Photosystem II.
                                
Resumo:
The introduction of non-toxic fluride compounds as direct replacements for Thorium Fluoride (ThF4) has renewed interest in the use of low index fluoride compounds in high performance infrared filters. This paper reports the results of an investigation into the effects of combining these low index materials, particularly Barium Fluoride (BaF2), with the high index material Lead Telluride (PbTe) in bandpass and edge filters. Infrared filter designs using conventional and the new material ombination are compared, and infrared filters using these material combinations have been manufactured and have been shown to suffer problems with residual stress. A possible solution to this problem utilising Zinc Sulphide (ZnS) layers with compensating compressive stress is discussed.
                                
Resumo:
Generalizing the notion of an eigenvector, invariant subspaces are frequently used in the context of linear eigenvalue problems, leading to conceptually elegant and numerically stable formulations in applications that require the computation of several eigenvalues and/or eigenvectors. Similar benefits can be expected for polynomial eigenvalue problems, for which the concept of an invariant subspace needs to be replaced by the concept of an invariant pair. Little has been known so far about numerical aspects of such invariant pairs. The aim of this paper is to fill this gap. The behavior of invariant pairs under perturbations of the matrix polynomial is studied and a first-order perturbation expansion is given. From a computational point of view, we investigate how to best extract invariant pairs from a linearization of the matrix polynomial. Moreover, we describe efficient refinement procedures directly based on the polynomial formulation. Numerical experiments with matrix polynomials from a number of applications demonstrate the effectiveness of our extraction and refinement procedures.
                                
Resumo:
In a recent paper, Vathsal suggested that a new configuration had been obtained for linear filtering problems, which was distinctly different from the Kalman-Bucy filter. It is shown that this in fact is merely a special case of the filter with a specified input.
                                
Resumo:
A complete treatment of the charcterastic admittance-matrix representation of multilayer thin-film systems with absorbing media is presented. The algorithm from the systems analysis is implemented on an IBM microcomputer and some examples of filter design calculation are presented. Relevant source code in IBM Advanced Basic interpreter are also included.
                                
Resumo:
A method of designing multi-cavity infrared narrowband filters for bandwidth between 10% and 20% is presended: The method is based on a Tschebyshev prototype. The theoretical indices from these are simulated by Herpin equivalent layers, the outer layers may be also simulated by Herrmann's asymetrical tri-layer. The new algorithm of filter design can easily be implemented in any microcomputer.
 
                    