The chromosomal assessment of salt tolerant substituted tritipyrum using genomic fluorescent in situ hybridiization (FISH)

Wheat, although moderately tolerant to salt, can not be cultivated in many areas. However, in the triticeae tribe, some of the wild wheat relatives are highly tolerant, e.g. Thinopyrum bessarabicum, which grows on the sea shore. Eight primary hexaploid tritipyrum lines, amphiploids between Triticum durum and Thinopyrum bessarabicum have been produced which can set seed in at least 250 mM NaCl. These tritipyrums (2n=6x=42, AABBEbEb) due to reasons such as brittle rachis, continuous production of tillers, late maturity, tall stature and meiotic instability will not fulfill the requirements of a successful commercial salt tolerant crop. To overcome such problems the substituted tritipyrum, in which selected Eb chromosomes are replaced by D genome chromosomes of 6x wheat, was produced from 6x tritipyrum x 6x wheat hybrids (F1: 2n=6x=42, AABBDEb) followed by selfing and backcrossing with 6x tritipyrum. The fertile plants among the above progenies were screened by the genomic fluorescent in situ hybridization technique to identify their Eb and D chromosome constitution. This study showed that producing tritiprum with variable numbers of Eb and D genome chromosomes is feasible and that FISH is a useful technique for determining the number of Eb chromosomes present.

Savory peptides present in Moromi obtained from soy sauce fermentation of yellow soybean

The presence of savory peptides in moromi has been investigated. Moromi was prepared by fermenting yellow soybean using Aspergillus oryzae as the starter at the first step (mold fermentation) and 20% brine solution at the next step (brine fermentation). The moromi was then ultrafiltered stepwise using membranes with MW cut-offs of 10,000, 3,000, and 500 Da, respectively. The fraction with MW < 500 Da was chromatographed using Sephadex G-25 SF to yield four fractions, 1-4. Analysis of soluble peptides, NaCl content, alpha-amino nitrogen, amino acid composition, peptide profile using CE coupled with DAD, taste profile and free glutamic acid content, were performed for each fraction. Fraction 2 contained a relatively high total glutamic acid content, but a relatively low free glutamic acid content and had the highest umami taste. This fraction also had more peptides containing non-aromatic amino acids than the other fractions. The peptides present in fraction 2 may play a role, at least in part, in its intense umami taste.

Wormlike micelle formation and flow alignment of a pluronic block copolymer in aqueous solution

The self-assembly into wormlike micelles of a poly(ethylene oxide)-b-poly(propylene oxide)-b-poly(ethylene oxide) triblock copolymer Pluronic P84 in aqueous salt solution (2 M NaCl) has been studied by rheology, small-angle X-ray and neutron scattering (SAXS/SANS), and light scattering. Measurements of the flow curves by controlled stress rheometry indicated phase separation under flow. SAXS on solutions subjected to capillary flow showed alignment of micelles at intermediate shear rates, although loss of alignment was observed for high shear rates. For dilute solutions, SAXS and static light scattering data on unaligned samples could be superposed over three decades in scattering vector, providing unique information on the wormlike micelle structure over several length scales. SANS data provided information on even shorter length scales, in particular, concerning "blob" scattering from the micelle corona. The data could be modeled based on a system of semiflexible self-avoiding cylinders with a circular cross-section, as described by the wormlike chain model with excluded volume interactions. The micelle structure was compared at two temperatures close to the cloud point (47 degrees C). The micellar radius was found not to vary with temperature in this region, although the contour length increased with increasing temperature, whereas the Kuhn length decreased. These variations result in an increase of the low-concentration radius of gyration with increasing temperature. This was consistent with dynamic light scattering results, and, applying theoretical results from the literature, this is in agreement with an increase in endcap energy due to changes in hydration of the poly(ethylene oxide) blocks as the temperature is increased.

Bending, twisting, and breaking CuCN chains to produce framework materials: the reactions of CuCN with alkali-metal halides

The reactions of the low-temperature polymorph of copper(I) cyanide (LT-CuCN) with concentrated aqueous alkali-metal halide solutions have been investigated. At room temperature, KX (X = Br and I) and CsX (X = Cl, Br, and I) produce the addition products K[Cu-2(CN)(2)Br](H2O)-H-. (I), K-3[Cu-6(CN)(6)I-3](.)2H(2)O (II), Cs[Cu-3(CN)(3)Cl] (III), Cs[Cu-3(CN)(3)Br] (IV), and Cs-2[Cu-4(CN)(4)I-2](H2O)-H-. (V), with 3-D frameworks in which the -(CuCN)- chains present in CuCN persist. No reaction occurs, however, with NaX (X = Cl, Br, I) or KCl. The addition compounds, I-V, reconvert to CuCN when washed. Both low- and high-temperature polymorphs of CuCN (LT- and HT-CuCN) are produced, except in the case of Cs[Cu-3(CN)(3)Cl] (III), which converts only to LT-CuCN. Heating similar AX-CuCN reaction mixtures under hydrothermal conditions at 453 K for 1 day produces single crystals of I-V suitable for structure determination. Under these more forcing conditions, reactions also occur with NaX (X = Cl, Br, I) and KCl. NaBr and KCl cause some conversion of LT-CuCN into HT-CuCN, while NaCl and NaI, respectively, react to form the mixed-valence Cu(I)/Cu(II) compounds [Cu-II(OH2)(4)][Cu-4(I)(CN)(6)], a known phase, and [Cu-II(OH2)(4)][Cu-4(I)(CN)(4)I-2] (VI), a 3-D framework, which contains infinite -(CuCN)- chains. After 3 days of heating under hydrothermal conditions, the reaction between KI and CuCN produces [Cu-II(OH2)(4)][Cu-2(I)(CN)I-2](2) (VII), in which the CuCN chains are broken into single Cu-CN-Cu units, which in turn are linked into chains via iodine atoms and then into layers via long Cu-C and Cu-Cu interactions.

Influence of environmental stress on distributions of times to first division in Escherichia coli populations, as determined by digital-image analysis of individual cells

The distributions of times to first cell division were determined for populations of Escherichia coli stationary-phase cells inoculated onto agar media. This was accomplished by using automated analysis of digital images of individual cells growing on agar and calculation of the "box area ratio." Using approximately 300 cells per experiment, the mean time to first division and standard deviation for cells grown in liquid medium at 37 degrees C and inoculated on agar and incubated at 20 degrees C were determined as 3.0 h and 0.7 h, respectively. Distributions were observed to tail toward the higher values, but no definitive model distribution was identified. Both preinoculation stress by heating cultures at 50 degrees C and postinoculation stress by growth in the presence of higher concentrations of NaCl increased mean times to first division. Both stresses also resulted in an increase in the spread of the distributions that was proportional to the mean division time, the coefficient of variation being constant at approximately 0.2 in all cases. The "relative division time," which is the time to first division for individual cells expressed in terms of the cell size doubling time, was used as measure of the "work to be done" to prepare for cell division. Relative division times were greater for heat-stressed cells than for those growing under osmotic stress.

Viability of Salmonella enterica subsp. enterica during the preparation and cold storage of Egyptian soft cheeses and ice-cream

Changes occurring in the viability of Salmonella enterica subsp. enterica during the preparation and cold storage of Domiati cheese, Kariesh cheese and ice-cream were examined. A significant decrease in numbers was observed after whey drainage during the manufacture of Domiati cheese, but Salmonella remained viable for 13 weeks in cheeses prepared from milks with between 60 and 100 g/L NaCl; the viability declined in Domiati cheese made from highly salted milk during the later stages of storage. The method of coagulation used in the preparation of Kariesh cheese affected the survival time of the pathogen, and it varied from 2 to 3 weeks in cheeses made with a slow-acid coagulation method to 4-5 weeks for an acid-rennet coagulation method. This difference was attributed to the higher salt-in-moisture levels and lower pH values of Kariesh cheese prepared by the slow-acid coagulation method. A slight decrease in the numbers of Salmonella resulted from ageing ice-cream mix for 24 h at 0degreesC, but a greater reduction was evident after one day of frozen storage at -20degreesC. The pathogen survived further frozen storage for four months without any substantial change in numbers.

Roseisalinus antarcticus gen. nov., sp nov., a novel aerobic bacteriochlorophyll a-producing alpha-proteobacterium isolated from hypersaline Ekho Lake, Antarctica

A Gram-negative, aerobic to microaerophilic rod was isolated from 10 m depths of the hypersaline, heliothermal and meromictic Ekho Lake (East Antarctica). The strain was oxidase- and catalase-positive, metabolized a variety of carboxylic acids and sugars and produced lipase. Cells had an absolute requirement for artificial sea water, which could not be replaced by NaCl. A large in vivo absorption band at 870 nm indicated production of bacteriochlorophyll a. The predominant fatty acids of this organism were 16:0 and 18:1omega7c, with 3-OH 10:0, 16:1omega7c and 18:0 in lower amounts. The main polar lipids were diphosphatidylglycerol, phosphatidylglycerol and phosphatidylcholine. Ubiquinone 10 was produced. The DNA G + C content was 67 mol%. 16S rRNA gene sequence comparisons indicated that the isolate represents a member of the Roseobacter clade within the alpha-Proteobacteria. The organism showed no particular relationship to any members of this clade but clustered on the periphery of the genera Jannaschia, Octadecabacter and 'Marinosulfonomonas' and the species Ruegeria gelatinovorans. Distinct morphological, physiological and genotypic differences to these previously described taxa supported the description of a new genus and a novel species, for which the name Roseisalinus antarcticus gen. nov., sp. nov. is proposed. The type strain is EL-88(T) (= DSM 11466(T) = CECT 7023(T)).

Effect of chymosin reduction and salt substitution on the properties of white salted cheese

A whey salts mixture was used as a partial substitute for sodium chloride to provide a modified Na:K ratio (1:3.4) in the manufacture of white salted cheese using ultrafiltration. Reduction of chymosin addition from 20 to 8 mu L kg(-1) of cheese was also investigated. Variation of salt and chymosin levels did not result in any significant differences in composition and physicochemical properties. The rates of proteolysis in terms of water-soluble nitrogen (WSN) and nitrogen soluble in 12% trichloroacetic acid (TCA-SN) were affected by chymosin levels but not by salt treatment. Urea-PAGE electrophoretic analysis of caseins from the cheeses manufactured using three levels of chymosin and two salt types showed that the hydrolysis of alpha(s1)-casein was higher than for beta-caseins but the differences between the cheeses were not significant (P > 0.05). The chymosin level did not have a significant effect (P > 0.05) on hardness and fracturability, suggesting that any variation in hardness due to the initial hydrolysis was being confounded by other variables. Cheeses including the whey salts product were harder and more fracturable (P < 0.01) than the cheese treated with NaCl only. Both hardness and fracturability values decreased (P < 0.05) over the maturation period. The scores for bitterness were low; neither the effects of salt nor chymosin levels were significant (P > 0.05). (c) 2005 Elsevier Ltd. All rights reserved.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Influence of salt on the self-assembly of two model amyloid heptapeptides

We study the effects of NaCl on the self-assembly of AAKLVFF and beta A beta AKLVFF in solution. Both AAKLVFF and beta A beta AKLVFF self-assemble into twisted fibers in aqueous solution. The addition of NaCl to aqueous solutions of AAKLVFF produces large crystal-like nanotapes which eventually precipitate. In contrast, highly twisted fibrils were observed for beta A beta AKLVFF solutions at low salt concentration, while a coexistence of highly twisted fibers and nanotubes was observed for beta A beta AKLVFF at high salt concentration. The self-assembled structures observed for beta A beta AKLVFF in NaCl solutions were ascribed to the progressive screening of the beta A beta AKLVFF surface charge caused by the addition of salt.

Molecular dynamics simulations of threadlike cetyltrimethylammonium chloride micelles: effects of sodium chloride and sodium salicylate salts

We use atomistic molecular dynamics simulations to probe the effects of added sodium chloride (NaCl) and sodium salicylate (NaSal) salts on the spherical-to-threadlike micelle shape transition in aqueous solutions of cetyltrimethylammonium chloride (CTAC) surfactants. Long threadlike micelles are found to be unstable and break into spherical micelles at low concentrations or NaCl, but remain stable for 20 ns above a threshold value of [NaCl] approximate to 3.0 M, which is about 2.5 times larger than the experimental salt concentration at which the transition between spherical and rodlike micelles occurs. The chloride counterions associate weakly oil the surface of the CTAC micelles with the degree of counterion dissociation decreasing slightly with increasing [NaCl] on spherical micelles, but dropping significantly on the threadlike micelles tit high [NaCl]. This effect indicates that the electrolyte ions drive the micellar shape transition by screening the electrostatic repulsions between the micellar headgroups, The aromatic salicylate counterions, on the other hand, penetrate inside the micelle with their hydrophilic groups staying in the surfactant headgroup region and the hydrophobic groups partially embedded into the hydrophobic core of the micelle. The strong association of the salicylate ions with the surfactant headgroups leads to dense packing of the surfactant molecules, which effectively reduces the surface area per surfactant, and increases intramicellar ordering of the surfactant headgroups, favoring the formation of long threadlike micelles. Simulation predictions of the geometric and electrostatic properties of the spherical and threadlike micelles are in good agreement with experiments.

Identification of components of the Sigma B Regulon in Listeria monocytogenes that contribute to acid and salt tolerance

Sigma B (σB) is an alternative sigma factor that controls the transcriptional response to stress in Listeria monocytogenes and is also known to play a role in the virulence of this human pathogen. In the present study we investigated the impact of a sigB deletion on the proteome of L. monocytogenes grown in a chemically defined medium both in the presence and in the absence of osmotic stress (0.5 M NaCl). Two new phenotypes associated with the sigB deletion were identified using this medium. (i) Unexpectedly, the strain with the ΔsigB deletion was found to grow faster than the parent strain in the growth medium, but only when 0.5 M NaCl was present. This phenomenon was independent of the carbon source provided in the medium. (ii) The ΔsigB mutant was found to have unusual Gram staining properties compared to the parent, suggesting that σB contributes to the maintenance of an intact cell wall. A proteomic analysis was performed by two-dimensional gel electrophoresis, using cells growing in the exponential and stationary phases. Overall, 11 proteins were found to be differentially expressed in the wild type and the ΔsigB mutant; 10 of these proteins were expressed at lower levels in the mutant, and 1 was overexpressed in the mutant. All 11 proteins were identified by tandem mass spectrometry, and putative functions were assigned based on homology to proteins from other bacteria. Five proteins had putative functions related to carbon utilization (Lmo0539, Lmo0783, Lmo0913, Lmo1830, and Lmo2696), while three proteins were similar to proteins whose functions are unknown but that are known to be stress inducible (Lmo0796, Lmo2391, and Lmo2748). To gain further insight into the role of σB in L. monocytogenes, we deleted the genes encoding four of the proteins, lmo0796, lmo0913, lmo2391, and lmo2748. Phenotypic characterization of the mutants revealed that Lmo2748 plays a role in osmotolerance, while Lmo0796, Lmo0913, and Lmo2391 were all implicated in acid stress tolerance to various degrees. Invasion assays performed with Caco-2 cells indicated that none of the four genes was required for mammalian cell invasion. Microscopic analysis suggested that loss of Lmo2748 might contribute to the cell wall defect observed in the ΔsigB mutant. Overall, this study highlighted two new phenotypes associated with the loss of σB. It also demonstrated clear roles for σB in both osmotic and low-pH stress tolerance and identified specific components of the σB regulon that contribute to the responses observed.

Changes in liking for a no added salt soup as a function of exposure

Multiple exposures have been shown to increase preference for novel foods or flavours. This "mere exposure" effect is also well known anecdotally for changes in preference for tastants within foods, for example reducing sugar in tea or coffee. However, to date, this phenomenon has received little scientific attention. The present study addressed this issue in relation to changes in preference for salt within soup. Following an initial assessment of liking, familiarity and saltiness of six soups varying in salt content (0 - 337 mg NaCl/ml), thirty-seven participants, previously assessed for their preferred salt level in soup, were allocated to either an exposure group that received 20 ml soup samples with no added salt, to a group that received a 280 ml bowl of this soup, or to a control group that received 20 ml soup samples containing salt at 280mg/100g (within normal, commercial range). Soups were presented on eight occasions, at approximately daily intervals. The two groups receiving the no added salt soup showed increases in liking starting at the third exposure, and also evident in a repeat assessment following the exposures. Increases in familiarity of the no added salt soup were also evident during exposure. Rated saltiness of all soups increased as a function of exposure, so a change in saltiness perception could not account for changes in liking for just the no added salt soups. These data suggest that simple exposure to the taste of the no added salt soup was sufficient to increase liking to a level equivalent to the initially more preferred salt level.

The p38-MAPK inhibitor, SB203580, inhibits cardiac stress-activated protein kinases/c-Jun N-terminal kinases (SAPKs/JNKs).

SB203580 is a recognised inhibitor of p38-MAPKs. Here, we investigated the effects of SB203580 on cardiac SAPKs/JNKs. The IC50 for inhibition of p38-MAPK stimulation of MAPKAPK2 was approximately 0.07 microM, whereas that for total SAPK/JNK activity was 3-10 microM. SB203580 did not inhibit immunoprecipitated JNK1 isoforms. Three peaks of SAPK/JNK activity were separated by anion exchange chromatography, eluting in the isocratic wash (44 kDa), and at 0.08 M (46 and 52 kDa) and 0.15 M NaCl (54 kDa). SB203580 (10 microM) completely inhibited the 0.15 M NaCl activity and partially inhibited the 0.08 M NaCl activity. Since JNK1 antibodies immunoprecipitate the 46 kDa activity, this indicates that SB203580 selectively inhibits 52 and 54 kDa SAPKs/JNKs.

Epidural analgesia with morphine or buprenorphine in ponies with lipopolysaccharide (LPS)-induced carpal synovitis

This study evaluated the analgesia effects of the epidural administration of 0.1 mg/kg bodyweight (BW) of morphine or 5 mu g/kg BW of buprenorphine in ponies with radiocarpal joint synovitis. Six ponies were submitted to 3 epidural treatments: the control group (C) received 0.15 mL/kg BW of a 0.9% sodium chloride (NaCl) solution; group M was administered 0.1 mg/kg BW of morphine; and group B was administered 5 mu g/kg BW of buprenorphine, both diluted in 0.9% NaCl to a total volume of 0.15 mL/kg BW administered epidurally at 10 s/mL. The synovitis model was induced by injecting 0.5 ng of lipopolysaccharide (LPS) in the left or right radiocarpal joint. An epidural catheter was later introduced in the lumbosacral space and advanced up to the thoracolumbar level. The treatment started 6 h after synovitis induction. Lameness, maximum angle of carpal flexion, heart rate, systolic arterial pressure, respiratory rate, temperature, and intestinal motility were evaluated before LPS injection (baseline), 6 h after LPS injection (time 0), and 0.5, 1, 2, 4, 6, 8, 10, 12, 16, 20, and 24 h after treatments. Although the model of synovitis produced clear clinical signs of inflammation, the lameness scores in group C were different from the baseline for only up to 12 h. Both morphine and buprenorphine showed a reduction in the degree of lameness starting at 0.5 and 6 h, respectively. Reduced intestinal motility was observed at 0.5 h in group M and at 0.5 to 1 h in group B. Epidural morphine was a more effective analgesic that lasted for more than 12 h and without side effects. It was concluded that morphine would be a valuable analgesic option to alleviate joint pain in the thoracic limbs in ponies.