Replication protein A binds to regulatory elements in yeast DNA repair and DNA metabolism genes.

Saccharomyces cerevisiae responds to DNA damage by arresting cell cycle progression (thereby preventing the replication and segregation of damaged chromosomes) and by inducing the expression of numerous genes, some of which are involved in DNA repair, DNA replication, and DNA metabolism. Induction of the S. cerevisiae 3-methyladenine DNA glycosylase repair gene (MAG) by DNA-damaging agents requires one upstream activating sequence (UAS) and two upstream repressing sequences (URS1 and URS2) in the MAG promoter. Sequences similar to the MAG URS elements are present in at least 11 other S. cerevisiae DNA repair and metabolism genes. Replication protein A (Rpa) is known as a single-stranded-DNA-binding protein that is involved in the initiation and elongation steps of DNA replication, nucleotide excision repair, and homologous recombination. We now show that the MAG URS1 and URS2 elements form similar double-stranded, sequence-specific, DNA-protein complexes and that both complexes contain Rpa. Moreover, Rpa appears to bind the MAG URS1-like elements found upstream of 11 other DNA repair and DNA metabolism genes. These results lead us to hypothesize that Rpa may be involved in the regulation of a number of DNA repair and DNA metabolism genes.

Regulatory region in choline acetyltransferase gene directs developmental and tissue-specific expression in transgenic mice.

Acetylcholine, one of the main neurotransmitters in the nervous system, is synthesized by the enzyme choline acetyltransferase (ChAT; acetyl-CoA:choline O-acetyltransferase, EC 2.3.1.6). The molecular mechanisms controlling the establishment, maintenance, and plasticity of the cholinergic phenotype in vivo are largely unknown. A previous report showed that a 3800-bp, but not a 1450-bp, 5' flanking segment from the rat ChAT gene promoter directed cell type-specific expression of a reporter gene in cholinergic cells in vitro. Now we have characterized a distal regulatory region of the ChAT gene that confers cholinergic specificity on a heterologous downstream promoter in a cholinergic cell line and in transgenic mice. A 2342-bp segment from the 5' flanking region of the ChAT gene behaved as an enhancer in cholinergic cells but as a repressor in noncholinergic cells in an orientation-independent manner. Combined with a heterologous basal promoter, this fragment targeted transgene expression to several cholinergic regions of the central nervous system of transgenic mice, including basal forebrain, cortex, pons, and spinal cord. In eight independent transgenic lines, the pattern of transgene expression paralleled qualitatively and quantitatively that displayed by endogenous ChAT mRNA in various regions of the rat central nervous system. In the lumbar enlargement of the spinal cord, 85-90% of the transgene expression was targeted to the ventral part of the cord, where cholinergic alpha-motor neurons are located. Transgene expression in the spinal cord was developmentally regulated and responded to nerve injury in a similar way as the endogenous ChAT gene, indicating that the 2342-bp regulatory sequence contains elements controlling the plasticity of the cholinergic phenotype in developing and injured neurons.

Chicken interferon consensus sequence-binding protein (ICSBP) and interferon regulatory factor (IRF) 1 genes reveal evolutionary conservation in the IRF gene family.

Members of the IRF family mediate transcriptional responses to interferons (IFNs) and to virus infection. So far, proteins of this family have been studied only among mammalian species. Here we report the isolation of cDNA clones encoding two members of this family from chicken, interferon consensus sequence-binding protein (ICSBP) and IRF-1. The predicted chicken ICSBP and IRF-1 proteins show high levels of sequence similarity to their corresponding human and mouse counterparts. Sequence identities in the putative DNA-binding domains of chicken and human ICSBP and IRF-1 were 97% and 89%, respectively, whereas the C-terminal regions showed identities of 64% and 51%; sequence relationships with mouse ICSBP and IRF-1 are very similar. Chicken ICSBP was found to be expressed in several embryonic tissues, and both chicken IRF-1 and ICSBP were strongly induced in chicken fibroblasts by IFN treatment, supporting the involvement of these factors in IFN-regulated gene expression. The presence of proteins homologous to mammalian IRF family members, together with earlier observations on the occurrence of functionally homologous IFN-responsive elements in chicken and mammalian genes, highlights the conservation of transcriptional mechanisms in the IFN system, a finding that contrasts with the extensive sequence and functional divergence of the IFNs.

The sulfur controller-2 negative regulatory gene of Neurospora crassa encodes a protein with beta-transducin repeats.

The sulfur regulatory system of Neurospora crassa is composed of a set of structural genes involved in sulfur catabolism controlled by a genetically defined set of trans-acting regulatory genes. These sulfur regulatory genes include cys-3+, which encodes a basic region-leucine zipper transcriptional activator, and the negative regulatory gene scon-2+. We report here that the scon-2+ gene encodes a polypeptide of 650 amino acids belonging to the expanding beta-transducin family of eukaryotic regulatory proteins. Specifically, SCON2 protein contains six repeated G beta-homologous domains spanning the C-terminal half of the protein. SCON2 represents the initial filamentous fungal protein identified in the beta-transducin group. Additionally, SCON2 exhibits a specific amino-terminal domain that potentially defines another subfamily of beta-transducin homologs. Expression of the scon-2+ gene has been examined using RNA hybridization and gel mobility-shift analysis. The dependence of scon-2+ expression on CYS3 function and the binding of CYS3 to the scon-2+ promoter indicate the presence of an important control loop within the N. crassa sulfur regulatory circuit involving CYS3 activation of scon-2+ expression. On the basis of the presence of beta-transducin repeats, the crucial role of SCON2 in the signal-response pathway triggered by sulfur limitation may be mediated by protein-protein interactions.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Comment Letter: The NYSE and the End of the Structural Separation between Regulatory and Commercial Interests of the Exchange

The NYSE transformed into a for profit entity in 2006. As part of the approval process, the NYSE agreed to structurally separate the regulatory function from the business function. In doing so, the NYSE created NYSE Regulation, a non-profit with an independent board, to handle most regulatory matters. During the comment period, a spirited debate arose over the ability of a for profit company to carry out a regulatory mission. Some suggested that the regulatory function was incompatible with a "for profit" motive and that NYSE Regulation should be spun off. Others accepted the proposed structure but called for additional changes designed to reduce the possible influence of the public holding company over the regulatory function. In the end, the SEC approved the structure but with a number of prophylactic safeguards including the requirement that NYSE Regulation have a board consisting of all independent directors (save the CEO) and that directors from the for profit holding company could not make up a majority of the board. More recently, however, the NYSE has proposed to end the structural separation of the two functions and instead put in place a functional separation. The proposal would result in the termination of the delegation agreement between the Exchange and NYSE Regulation and the creation of both a Regulatory Oversight Committee of the Board of Directors of the Exchange and the creation of a Chief Regulatory Officer. This letter examines the history of the separation of the two functions and critiques the NYSE's proposal.

A Regulatory Compliance Plan for Decommissioning a Sodium Phosphate Manufacturing Plant

Sodium phosphates are a class of chemicals that have been widely employed in commercial and consumer applications. However, declining use of these chemicals due to environmental concerns has lead to restructuring within the industry that has caused, and is likely to continue to cause, reduction of sodium phosphate production capacity. Closure of a sodium phosphate manufacturing plant necessitates decommissioning and decontamination activities that are subject to a variety of federal, state, and local regulations. A compliance plan was developed to provide a blueprint for ensuring that all federal regulatory requirements are met, however, site dependent state and local requirements were excluded. The compliance plan provides a framework that addresses project team formation and project planning, regulatory requirements, identification of affected processing equipment, plant pre-shutdown activities, waste stream identification and waste management facilities, safety, training, and emergency preparedness planning, and project decommissioning remedial actions. This regulatory compliance plan will enable sodium phosphate plant operators to complete decontamination and decommissioning work in a timely, efficient, compliant, and cost effective manner.

Performance Septic Systems: Does an Advanced Septic System Provide Adequate Treatment on Black Hammock Island and is there Adequate Regulatory Policy to Ensure Integrity?

This project determined if the performance based septic system, proposed for a development on Black Hammock Island in Jacksonville, Florida, is the best choice to prevent environmental contamination from septic tanks and if adequate regulatory policy exists. Research shows a central wastewater treatment plant provides the most efficient pollutant removal but can be cost prohibitive. This project found performance based systems surpasses conventional septic system performance and are more suited and economical to remote areas without sewer service. This project finds current regulations to be inadequate and supports ordinance changes proposed by the Mayor of Jacksonville to enhance the current policy and provide more adequate and meaningful regulation.

The New Financial Regulatory Paradigm: A transatlantic perspective. CEPS Policy Brief No. 287, 21 March 2013

This CEPS Policy Brief reviews key aspects of the new financial paradigm in a transatlantic perspective, focusing on the general approach in EU and US legislation in response to the financial crisis and the G-20 commitments and specifically as regards the extraterritorial implications. Following discussion of the institutional setting, conclusions are offered on what these changes mean in the context of the recently proposed Transatlantic Trade and Investment Partnership. In comparing the EU and the US efforts in re-engineering their regulatory regimes in response to the financial crisis, the paper finds, with the notable exception of the banking union, serious grounds for concern that the outcome may be an even more fragmented European financial market, access to which for third-country institutions is highly problematic.

Banking Union with a Sovereign Virus. The self-serving regulatory treatment of sovereign debt in the euro area. CEPS Policy Brief No. 289, 27 March 2013

In many eurozone countries, domestic banks often hold more than 20% of domestic public debt, which is an unsatisfactory situation given that banks are highly leveraged and that sovereign debt is inherently subject to default risk within the euro area. This paper by Daniel Gros finds, however, that the relative concentration of public debt on bank balance sheets is not just a result of the euro crisis, for there are strong additional incentives for banks in some countries to increase their sovereign. His contribution discusses a number of these regulatory incentives – the most important of which is specific to the euro area – and explores ways in which euro area banks can be weaned from massive investments in government bonds.

Human naïve regulatory T-cells feature high steady-state turnover and are maintained by IL-7

Naïve FoxP3-expressing regulatory T-cells (Tregs) are essential to control immune responses via continuous replenishment of the activated-Treg pool with thymus-committed suppressor cells. The mechanisms underlying naïve-Treg maintenance throughout life in face of the age-associated thymic involution remain unclear. We found that in adults thymectomized early in infancy the naïve-Treg pool is remarkably well preserved, in contrast to conventional naïve CD4 T-cells. Naïve-Tregs featured high levels of cycling and pro-survival markers, even in healthy individuals, and contrasted with other circulating naïve/memory CD4 T-cell subsets in terms of their strong γc-cytokine-dependent signaling, particularly in response to IL-7. Accordingly, ex-vivo stimulation of naïve-Tregs with IL-7 induced robust cytokine-dependent signaling, Bcl-2 expression, and phosphatidylinositol 3-kinase (PI3K)-dependent proliferation, whilst preserving naïve phenotype and suppressive capacity. Altogether, our data strongly implicate IL-7 in the thymus-independent long-term survival of functional naïve-Tregs, and highlight the potential of targeting the IL-7 pathway to modulate Tregs in different clinical settings.

The Dutch wish-list for a lighter regulatory touch from the EU. CEPS Commentary, 1 July 2013

The Dutch government set out the results of its review of EU competences on June 21st, under the slogan “European where necessary, national where possible”, claiming that the EU does not adequately respect the principles of subsidiarity and proportionality. It published a list of 54 points for corrective action, which Michael Emerson assesses in this new CEPS Commentary. The political significance of this initiative is heightened because it comes alongside the UK's ongoing review of EU competences, although unlike the British, the Dutch make no mention of secession, treaty changes or repatriation of competences.