887 resultados para NEUTRON-CAPTURE ELEMENTS


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Geological carbon dioxide storage (CCS) has the potential to make a significant contribution to the decarbonisation of the UK. Amid concerns over maintaining security, and hence diversity, of supply, CCS could allow the continued use of coal, oil and gas whilst avoiding the CO2 emissions currently associated with fossil fuel use. This project has explored some of the geological, environmental, technical, economic and social implications of this technology. The UK is well placed to exploit CCS with a large offshore storage capacity, both in disused oil and gas fields and saline aquifers. This capacity should be sufficient to store CO2 from the power sector (at current levels) for a least one century, using well understood and therefore likely to be lower-risk, depleted hydrocarbon fields and contained parts of aquifers. It is very difficult to produce reliable estimates of the (potentially much larger) storage capacity of the less well understood geological reservoirs such as non-confined parts of aquifers. With the majority of its large coal fired power stations due to be retired during the next 15 to 20 years, the UK is at a natural decision point with respect to the future of power generation from coal; the existence of both national reserves and the infrastructure for receiving imported coal makes clean coal technology a realistic option. The notion of CCS as a ‘bridging’ or ‘stop-gap’ technology (i.e. whilst we develop ‘genuinely’ sustainable renewable energy technologies) needs to be examined somewhat critically, especially given the scale of global coal reserves. If CCS plant is built, then it is likely that technological innovation will bring down the costs of CO2 capture, such that it could become increasingly attractive. As with any capitalintensive option, there is a danger of becoming ‘locked-in’ to a CCS system. The costs of CCS in our model for UK power stations in the East Midlands and Yorkshire to reservoirs in the North Sea are between £25 and £60 per tonne of CO2 captured, transported and stored. This is between about 2 and 4 times the current traded price of a tonne of CO2 in the EU Emissions Trading Scheme. In addition to the technical and economic requirements of the CCS technology, it should also be socially and environmentally acceptable. Our research has shown that, given an acceptance of the severity and urgency of addressing climate change, CCS is viewed favourably by members of the public, provided it is adopted within a portfolio of other measures. The most commonly voiced concern from the public is that of leakage and this remains perhaps the greatest uncertainty with CCS. It is not possible to make general statements concerning storage security; assessments must be site specific. The impacts of any potential leakage are also somewhat uncertain but should be balanced against the deleterious effects of increased acidification in the oceans due to uptake of elevated atmospheric CO2 that have already been observed. Provided adequate long term monitoring can be ensured, any leakage of CO2 from a storage site is likely to have minimal localised impacts as long as leaks are rapidly repaired. A regulatory framework for CCS will need to include risk assessment of potential environmental and health and safety impacts, accounting and monitoring and liability for the long term. In summary, although there remain uncertainties to be resolved through research and demonstration projects, our assessment demonstrates that CCS holds great potential for significant cuts in CO2 emissions as we develop long term alternatives to fossil fuel use. CCS can contribute to reducing emissions of CO2 into the atmosphere in the near term (i.e. peak-shaving the future atmospheric concentration of CO2), with the potential to continue to deliver significant CO2 reductions over the long term.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The paper presents the techno-economic modelling of CO2 capture process in coal-fired power plants. An overall model is being developed to compare carbon capture and sequestration options at locations within the UK, and for studies of the sensitivity of the cost of disposal to changes in the major parameters of the most promising solutions identified. Technological options of CO2 capture have been studied and cost estimation relationships (CERs) for the chosen options calculated. Created models are related to the capital, operation and maintenance cost. A total annualised cost of plant electricity output and amount of CO2 avoided have been developed. The influence of interest rates and plant life has been analysed as well. The CERs are included as an integral part of the overall model.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The evaluation of life cycle greenhouse gas emissions from power generation with carbon capture and storage (CCS) is a critical factor in energy and policy analysis. The current paper examines life cycle emissions from three types of fossil-fuel-based power plants, namely supercritical pulverized coal (super-PC), natural gas combined cycle (NGCC) and integrated gasification combined cycle (IGCC), with and without CCS. Results show that, for a 90% CO2 capture efficiency, life cycle GHG emissions are reduced by 75-84% depending on what technology is used. With GHG emissions less than 170 g/kWh, IGCC technology is found to be favorable to NGCC with CCS. Sensitivity analysis reveals that, for coal power plants, varying the CO2 capture efficiency and the coal transport distance has a more pronounced effect on life cycle GHG emissions than changing the length of CO2 transport pipeline. Finally, it is concluded from the current study that while the global warming potential is reduced when MEA-based CO2 capture is employed, the increase in other air pollutants such as NOx and NH3 leads to higher eutrophication and acidification potentials.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The compounds chlorothiazide and hydrochlorothiazide (crystalline form II) have been studied in their fully hydrogenous forms by powder neutron diffraction on the GEM diffractometer. The results of joint Rietveld refinement of the structures against multi-bank neutron and single-bank X-ray powder data are reported and show that accurate and precise structural information can be obtained from polycrystalline molecular organic materials by this route.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Polymer conjugates are nano-sized, multicomponent constructs already in the clinic as anticancer compounds, both as single agents or as elements of combinations. They have the potential to improve pharmacological therapy of a variety of solid tumors. Polymer-drug conjugation promotes passive tumor targeting by the enhanced permeability and retention (EPR) effect and allows for lysosomotropic drug delivery following endocytic capture. In the first part of this review, we analyze the promising results arising from clinical trials of polymer-bound chemotherapy. The experience gained on these studies provides the basis for the development of a more sophisticated second-generation of polymer conjugates. However, many challenges still lay ahead providing scope to develop and refine this field. The "technology platform'' of polymer therapeutics allows the development of both new and exciting polymeric materials, the incorporation of novel bioactive agents and combinations thereof to address recent advances in drug therapy. The rational design of polymer drug conjugates is expected to realize the true potential of these "nanomedicines".

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Static movement aftereffects (MAEs) were measured after adaptation to vertical square-wave luminance gratings drifting horizontally within a central window in a surrounding stationary vertical grating. The relationship between the stationary test grating and the surround was manipulated by varying the alignment of the stationary stripes in the window and those in the surround, and the type of outline separating the window and the surround [no outline, black outline (invisible on black stripes), and red outline (visible throughout its length)]. Offsetting the stripes in the window significantly increased both the duration and ratings of the strength of MAEs. Manipulating the outline had no significant effect on either measure of MAE strength. In a second experiment, in which the stationary test fields alone were presented, participants judged how segregated the test field appeared from its surround. In contrast to the MAE measures, outline as well as offset contributed to judged segregation. In a third experiment, in which test-stripe offset wits systematically manipulated, segregation ratings rose with offset. However, MAE strength was greater at medium than at either small or large (180 degrees phase shift) offsets. The effects of these manipulations on the MAE are interpreted in terms of a spatial mechanism which integrates motion signals along collinear contours of the test field and surround, and so causes a reduction of motion contrast at the edges of the test field.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Repeat induced point mutation (RIP), a mechanism causing hypermutation of repetitive DNA sequences in fungi, has been described as a ‘genome defense’ which functions to inactivate mobile elements and inhibit their deleterious effects on genome stability. Here we address the interactions between RIP and transposable elements in the Microbotryum violaceum species complex. Ten strains of M. violaceum, most of which belong to different species of the fungus, were all found to contain intragenomic populations of copia-like retrotransposons. Intragenomic DNA sequence variation among the copia-like elements was analyzed for evidence of RIP. Among species with RIP, there was no significant correlation between the frequency of RIP-induced mutations and inferred transposition rate based on diversity. Two strains of M. violaceum, from two different plant species but belonging to the same fungal lineage, contained copia-like elements with very low diversity, as would result from a high transposition rate, and these were also unique in showing no evidence of the hypermutation patterns indicative of the RIP genome defense. In this species, evidence of RIP was also absent from a Class II helitron-like transposable element. However, unexpectedly the absolute repetitive element load was lower than in other strains.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Electrospinning is a technique employed to produce nanoscale to microscale sized fibres by the application of a high voltage to a spinneret containing a polymer solution. Here we examine how small angle neutron scattering data can be modelled to analyse the polymer chain conformation. We prepared 1:1 blends of deuterated and hydrogenated atactic-polystyrene fibres from solutions in N, N-Dimethylformamide and Methyl Ethyl Ketone. The fibres themselves often contain pores or voiding within the internal structure on the length scales that can interfere with scattering experiments. A model to fit the scattering data in order to obtain values for the radius of gyration of the polymer molecules within the fibres has been developed, that includes in the scattering from the voids. Using this model we find that the radius of gyration is 20% larger than in the bulk state and the chains are slightly extended parallel to the fibre axis.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Zn(CN)2 and Ni(CN)2 are known for exhibiting anomalous thermal expansion over a wide temperature range. The volume thermal expansion coefficient for the cubic, three dimensionally connected material, Zn(CN)2, is negative (alpha(V) = −51  10(-6) K-1) while for Ni(CN)2, a tetragonal material, the thermal expansion coefficient is negative in the two dimensionally connected sheets (alpha(a) = −7  10(-6) K-1), but the overall thermal expansion coefficient is positive (alpha(V) = 48  10(-6) K-1). We have measured the temperature dependence of phonon spectra in these compounds and analyzed them using ab initio calculations. The spectra of the two compounds show large differences that cannot be explained by simple mass renormalization of the modes involving Zn (65.38 amu) and Ni (58.69 amu) atoms. This reflects the fact that the structure and bonding are quite different in the two compounds. The calculated pressure dependence of the phonon modes and of the thermal expansion coefficient, alpha(V), are used to understand the anomalous behavior in these compounds. Our ab initio calculations indicate that phonon modes of energy approx. 2 meV are major contributors to negative thermal expansion (NTE) in both the compounds. The low-energy modes of approx.8 and 13 meV in Zn(CN)2 also contribute significantly to the NTE in Zn(CN)2 and Ni(CN)2, respectively. The measured temperature dependence of the phonon spectra has been used to estimate the total anharmonicity of both compounds. For Zn(CN)2, the temperature-dependent measurements (total anharmonicity), along with our previously reported pressure dependence of the phonon spectra (quasiharmonic), is used to separate the explicit temperature effect at constant volume (intrinsic anharmonicity).