NOVEL THERAPEUTIC TARGETS IDENTIFIED BY HIGH-THROUGHPUT TECHNOLOGIES FOR TRIPLE-NEGATIVE BREAST CANCER

Triple-negative breast cancers (TNBC) are characterized by the lack of or reduced expression of the estrogen and progesterone receptors, and normal expression of the human epidermal growth factor receptor 2. The lack of a well-characterized target for treatment leaves only systemic chemotherapy as the mainstay of treatment. Approximately 60-70% of patients are chemosensitive, while the remaining majority does not respond. Targeted therapies that take advantage of the unique molecular perturbations found in triple-negative breast cancer are needed. The genes that are frequently amplified or overexpressed represent potential therapeutic targets for triple-negative breast cancer. The purpose of this study was to identify and validate novel therapeutic targets for triple-negative breast cancers. 681 genes showed consistent and highly significant overexpression in TNBC compared to receptor-positive cancers in 2 data sets. For two genes, 3 of the 4 siRNAs showed preferential growth inhibition in TNBC cells. These two genes were the low density lipoprotein receptor-related protein 8 (LRP8) and very low-density lipoprotein receptor (VLDLR). Exposure to their cognate ligands, reelin and apolipoprotein E isoform 4 (ApoE4), stimulated the growth of TNBC cells in vitro. Suppression of the expression of either LRP8 or VLDLR or exposure to RAP (an inhibitor of ligand binding to LRP8 and VLDLR) abolished this ligand-induced proliferation. High-throughput protein and metabolic arrays revealed that ApoE4 stimulation rescued TNBC cells from serum-starvation induced up-regulation of genes involved in lipid biosynthesis, increased protein expression of oncogenes involved in the MAPK/ERK and DNA repair pathways, and reduced the serum-starvation induction of biochemicals involved in oxidative stress response and glycolytic metabolism. shLRP8 MDA-MB-231 xenografts had reduced tumor volume, in comparison to parental and shCON xenografts. These results indicate that LRP8-APOE signaling confers survival advantages to TNBC tumors under reduced nutrient conditions and during cellular environmental stress. We revealed that the LRP8-APOE receptor-ligand system is overexpressed in human TNBC. We also demonstrated that this receptor system mediates a strong growth promoting and survival function in TNBC cells in vitro and helps to sustain the growth of MDA-MD-231 xenografts. We propose that inhibitors of LRP8-APOE signaling may be clinically useful therapeutic agents for triple-negative breast cancer.

Transcriptional regulation of the {\it neu\/} oncogene and its negative regulation by the c-{\it myc\/} oncogene

The first part of my research involved the characterization of the neu gene promoter. I subcloned a 2.2-kb sequence located upstream to the extreme 5$\sp\prime$ end of the neu gene, in front of the bacterial reporter gene, chloramphenicol acetyltransferase (CAT). Transfection of this construct into different cell lines and subsequent CAT assays demonstrated that this 2.2-kb fragment was functional as a promoter. A series of deletion constructs was engineered to study the contribution of different fragments to transcription. Subcloning of individual fragments was followed by a cotransfection competition experiment, which demonstrated the involvement of protein factors interacting with the promoter. A gel retardation assay was also performed to show the physical binding of protein factors to the promoter. The combined results suggested that both positively and negatively acting protein factors are involved in interacting with different regions of the promoter, contributing to the overall transcription activity. My findings provide an insight into the regulation of neu gene expression, which in turn provides the tools to understand the molecular mechanisms of overexpression of the neu gene in some breast cancer and ovarian cancer cell lines.^ In the second part of my research, I discovered that another oncogene, c-myc, was able to reverse the transformed morphology that was induced by the neu oncogene. Utilizing the promoter constructs that I made, I was able to show that the c-myc oncogene has a negative regulatory effect on the expression of the neu oncogene. Further studies suggested that c-myc is able to lower the effective concentration of a positive factor(s) that interact with a 139-bp fragment of the neu gene promoter. These findings may provide a direct evidence of the long suspected role of the c-myc gene in transcriptional regulation. The neu gene may very well be the first identified mammalian target gene that is regulated by the c-myc oncogene. Since c-myc is known to be stimulated by various mitogenic signals and the neu gene is likely to be a growth factor receptor, it is possible that c-myc, when stimulated by the signal transduction pathway of the neu gene, would function as a negative feedback regulator on the neu gene receptor. (Abstract shortened with permission of author.) ^

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Creation of a retinoblastoma mutant with dominant -negative activity

The Retinoblastoma tumor suppressor gene (RB) plays a role in a variety of human cancers. Experimental analyses have indicated that the protein product of the RB gene (pRb) plays a role in cell cycle regulation, and that this protein is required in cellular differentiation, senescence, and cell survival. pRb function is dependent on its ability to bind to cellular factors. There are multiple protein binding domains within pRb. Mutations within these domains which eliminate the ability of pRb to bind its targets result in loss of function. Loss of pRb function leads to tumorigenesis, although uncontrolled cellular proliferation is not a universal response to pRb inactivation. The ultimate response to the loss of pRb is influenced by both the genetic and epigenetic environments. Targeted disruption of RB in mice results in embryonic lethality, demonstrating the requirement for functional pRb in development. Close examination of various tissues from the embryos which lack wildtype RB shows problems in differentiation as well as showing induction of apoptosis. Although disruption of RB has provided useful information, complete inactivation of a gene precludes the possibility of discovering the functions that separate domains may have within the system. Creation of a dominant negative mutant by domain deletion whose phenotype is expressed in the presence of the wildtype may provide information about the intermediate functions of the protein. In addition, tissue specific targeting of a dominant negative mutant of pRb allows for comprehensive analysis of pRb function in organogenesis. In this thesis, a series of RB deletion mutants were created and tested for dominant negative activity as well as cellular localization. A tissue culture assay for dominant negative activity was developed which screens for the phenotype of apoptosis due to loss of pRb function. Two mutants from this series scored positive for dominant negative activity in this assay. The effect of these mutants within the assay environment can be explained by a model in which pRb acts as a facilitator of cell fate pathway decisions. ^

The role of Ski/Sno oncoproteins as negative regulators of the TGF-beta/SMAD signaling pathway in B -cell non -Hodgkin's lymphoma (NHL-B)

Non-Hodgkin's lymphomas are common tumors of the human immune system, primarily of B cell lineage (NHL-B). Negative growth regulation in the B cell lineage is mediated primarily through the TGF-β/SMAD signaling pathway that regulates a variety of tumor suppressor genes. Ski was originally identified as a transforming oncoprotein, whereas SnoN is an isoform of the Sno protein that shares a large region of homology with Ski. In this study, we show that Ski/SnoN are endogenously over-expressed both in patients' lymphoma cells and NHL-B cell lines. Exogenous TGF-β1 treatment induces down-regulation of Ski and SnoN oncoprotein expression in an NHL-B cell line, implying that Ski and SnoN modulate the TGF-β signaling pathway and are involved in cell growth regulation. Furthermore, we have developed an NHL-B cell line (DB) that has a null mutation in TGF-β receptor type II. In this mutant cell line, Ski/SnoN proteins are not down-regulated in response to TGF-β1 treatment, suggesting that downregulation of Ski and SnoN proteins in NHL-B require an intact functional TGF-β signaling pathway Resting normal B cells do not express Ski until activated by antigens and exogenous cytokines, whereas a low level of SnoN is also present in peripheral blood Go B cells. In contrast, autonomously growing NHL-B cells over-express Ski and SnoN, implying that Ski and SnoN are important cell cycle regulators. To further investigate a possible link between reduction of the Ski protein level and growth inhibition, Ski antisense oligodeoxynucleotides were transfected into NHL-B cells. The Ski protein level was found to decrease to less than 40%, resulting in restoring the effect of TGF-β and leading to cell growth inhibition and G1 cell cycle arrest. Co-immunoprecipitation experiments demonstrated that Ski associates with Smad4 in the nucleus, strongly suggesting that over-expression of the nuclear protein Ski and/or SnoN negatively regulates the TGF-β pathway, possibly by modulating Smad-mediated tumor suppressor gene expression. Together, in NHL-B, the TGF-β/SMAD growth inhibitory pathway is usually intact, but over-expression of the Ski and/or SnoN, which binds to Smad4, abrogates the negative regulatory effects of TGF-β/SMAD in lymphoma cell growth and potentiates the growth potential of neoplastic B cells. ^

Determinación de la actividad de la óxido nítrico sintetasa endotelial y del factor NF-kB, en la piel del paciente con pseudoangiomatosis eruptiva : informe preliminar

La pseudoangiomatosis eruptiva se caracteriza por la aparición brusca de múltiples pápulas eritematosas, asintomáticas, rodeadas de un halo blanquecino, con remisión espontánea. Histológicamente se observa dilatación vascular con escaso infiltrado inflamatorio. Su etiología permanece incierta a pesar de ser relacionada con virus o picaduras de insectos. Basados en el compromiso vascular, el objetivo del trabajo fue investigar la actividad de la enzima endotelial oxido nítrico sintetasa (eNOS) y la expresión del factor NF-kB por inmunohistoquimica en un intento de esclarecer su patogenia. Material y métodos: Se estudiaron diez pacientes con diagnóstico clínico de pseudoangiomatosis eruptiva (PAE) que presentaron la dermatosis en forma epidémica. Se realizaron biopsias teñidas con Hematoxilina-Eosina y Tricrómico de Masson. Se efectuó estudio virológico de los pacientes Nª 4, 9 y 10 mediante determinaciones serológicas para echovirus, enterovirus, citomegalovirus, parvovirus B19 y hepatitis A, B y C. En cinco pacientes se obtuvo material para determinación de eNOS y NF-kB. Resultados: Todos los pacientes, 5 hombres y 5 mujeres presentaron pápulas eritematosas rodeadas por un halo blanquecino, especialmente en las extremidades, alrededor de las rodillas. Histológicamente mostraron vasos dilatados y células endoteliales prominentes con un infiltrado discreto perivascular. Todos los estudios serológicos fueron negativos. La actividad de eNOS fue significativamente menor comparada con la piel normal (p= 0,002) y la expresión de NF- ĸB fue fuertemente positiva en los vasos de la dermis papilar y reticular. Conclusiones: Todos los pacientes fueron afectados en verano, por lo que la picadura del mosquito debe ser considerada como un factor etiológico. La baja expresión de eNOS está relacionada con la vasodilatación y la expresión aumentada de NF-ĸB confirma que el proceso es de tipo inflamatorio.

Decreased light availability can amplify negative impacts of ocean acidification on calcifying coral reef organisms

Coral reef organisms are increasingly and simultaneously affected by global and local stressors such as ocean acidification (OA) and reduced light availability. However, knowledge of the interplay between OA and light availability is scarce. We exposed 2 calcifying coral reef species (the scleractinian coral Acropora millepora and the green alga Halimeda opuntia) to combinations of ambient and increased pCO2 (427 and 1073 µatm, respectively), and 2 light intensities (35 and 150 µmol photons/m**2/s) for 16 d. We evaluated the individual and combined effects of these 2 stressors on weight increase, calcification rates, O2 fluxes and chlorophyll a content for the species investigated. Weight increase of A. millepora was significantly reduced by OA (48%) and low light intensity (96%) compared to controls. While OA did not affect coral calcification in the light, it decreased calcification in the dark by 155%, leading to dissolution of the skeleton. H. opuntia weight increase was not affected by OA, but decreased (40%) at low light. OA did not affect algae calcification in the light, but decreased calcification in the dark by 164%, leading to dissolution. Low light significantly reduced gross photosynthesis (56 and 57%), net photosynthesis (62 and 60%) and respiration (43 and 48%) of A. millepora and H. opuntia, respectively. In contrast to A. millepora, H. opuntia significantly increased chlorophyll content by 15% over the course of the experiment. No interactive effects of OA and low light intensity were found on any response variable for either organism. However, A. millepora exhibited additive effects of OA and low light, while H. opuntia was only affected by low light. Thus, this study suggests that negative effects of low light and OA are additive on corals, which may have implications for management of river discharge into coastal coral reefs.

Negative effects of ocean acidification on calcification vary within the coccolithophore genus Calcidiscus

A large percentage of CO2 emitted into the atmosphere is absorbed by the oceans, causing chemical changes in surface waters known as ocean acidification (OA). Despite the high interest and increased pace of OA research to understand the effects of OA on marine organisms, many ecologically important organisms remain unstudied. Calcidiscus is a heavily calcified coccolithophore genus that is widespread and genetically and morphologically diverse. It contributes substantially to global calcium carbonate production, organic carbon production, oceanic carbon burial, and ocean-atmosphere CO2 exchange. Despite the importance of this genus, relatively little work has examined its responses to OA. We examined changes in growth, morphology, and carbon allocation in multiple strains of Calcidiscus leptoporus in response to ocean acidification. We also, for the first time, examined the OA response of Calcidiscus quadriperforatus, a larger and more heavily calcified Calcidiscus congener. All Calcidiscus coccolithophores responded negatively to OA with impaired coccolith morphology and a decreased ratio of particulate inorganic to organic carbon (PIC:POC). However, strains responded variably; C. quadriperforatus showed the most sensitivity, while the most lightly calcified strain of C. leptoporus showed little response to OA. Our findings suggest that calcium carbonate production relative to organic carbon production by Calcidiscus coccolithophores may decrease in future oceans and that Calcidiscus distributions may shift if more resilient strains and species become dominant in assemblages. This study demonstrates that variable responses to OA may be strain or species specific in a way that is closely linked to physiological traits, such as cellular calcite quota.

Diffusion boundary layers ameliorate the negative effects of ocean acidification on the temperate coralline macroalga Arthrocardia corymbosa

Anthropogenically-modulated reductions in pH, termed ocean acidification, could pose a major threat to the physiological performance, stocks, and biodiversity of calcifiers and may devalue their ecosystem services. Recent debate has focussed on the need to develop approaches to arrest the potential negative impacts of ocean acidification on ecosystems dominated by calcareous organisms. In this study, we demonstrate the role of a discrete (i.e. diffusion) boundary layer (DBL), formed at the surface of some calcifying species under slow flows, in buffering them from the corrosive effects of low pH seawater. The coralline macroalga Arthrocardia corymbosa was grown in a multifactorial experiment with two mean pH levels (8.05 'ambient' and 7.65 a worst case 'ocean acidification' scenario projected for 2100), each with two levels of seawater flow (fast and slow, i.e. DBL thin or thick). Coralline algae grown under slow flows with thick DBLs (i.e., unstirred with regular replenishment of seawater to their surface) maintained net growth and calcification at pH 7.65 whereas those in higher flows with thin DBLs had net dissolution. Growth under ambient seawater pH (8.05) was not significantly different in thin and thick DBL treatments. No other measured diagnostic (recruit sizes and numbers, photosynthetic metrics, %C, %N, %MgCO3) responded to the effects of reduced seawater pH. Thus, flow conditions that promote the formation of thick DBLs, may enhance the subsistence of calcifiers by creating localised hydrodynamic conditions where metabolic activity ameliorates the negative impacts of ocean acidification.

Negative effects of ocean acidification on two crustose coralline species using genetically homogeneous samples

We evaluated acidification effects on two crustose coralline algal species common to Pacific coral reefs, Lithophyllum kotschyanum and Hydrolithon samoense. We used genetically homogeneous samples of both species to eliminate misidentification of species. The growth rates and percent calcification of the walls of the epithallial cells (thallus surface cells) of both species decreased with increasing pCO2. However, elevated pCO2 more strongly inhibited the growth of L. kotschyanum versus H. samoense. The trend of decreasing percent calcification of the cell wall did not differ between these species, although intercellular calcification of the epithallial cells in L. kotschyanum was apparently reduced at elevated pCO2, a result that might indicate that there are differences in the solubility or density of the calcite skeletons of these two species. These results can provide knowledge fundamental to future studies of the physiological and genetic mechanisms that underlie the response of crustose coralline algae to environmental stresses.

Negative effects of ocean acidification on calcification vary within the coccolithophore genus Calcidiscus

A large percentage of CO2 emitted into the atmosphere is absorbed by the oceans, causing chemical changes in surface waters known as ocean acidification (OA). Despite the high interest and increased pace of OA research to understand the effects of OA on marine organisms, many ecologically important organisms remain unstudied. Calcidiscus is a heavily calcified coccolithophore genus that is widespread and genetically and morphologically diverse. It contributes substantially to global calcium carbonate production, organic carbon production, oceanic carbon burial, and ocean-atmosphere CO2 exchange. Despite the importance of this genus, relatively little work has examined its responses to OA. We examined changes in growth, morphology, and carbon allocation in multiple strains of Calcidiscus leptoporus in response to ocean acidification. We also, for the first time, examined the OA response of Calcidiscus quadriperforatus, a larger and more heavily calcified Calcidiscus congener. All Calcidiscus coccolithophores responded negatively to OA with impaired coccolith morphology and a decreased ratio of particulate inorganic to organic carbon (PIC:POC). However, strains responded variably; C. quadriperforatus showed the most sensitivity, while the most lightly calcified strain of C. leptoporus showed little response to OA. Our findings suggest that calcium carbonate production relative to organic carbon production by Calcidiscus coccolithophores may decrease in future oceans and that Calcidiscus distributions may shift if more resilient strains and species become dominant in assemblages. This study demonstrates that variable responses to OA may be strain or species specific in a way that is closely linked to physiological traits, such as cellular calcite quota.

Negative Bubbles and Unpredictability of Financial Markets: The Asian Currency Crisis in 1997

We obtain the three following conclusions. First, business cycles depend on prices of stocks and primary commodities such as crude oil. Second, stock prices and oil prices generate psychological cycles with different periods. Third, there exist cases of "negative bubble" under certain conditions. Integrating the above results, we can find a role of a government in financial market in developing countries.

Myanmar's two decades of partial transition to a market economy : a negative legacy for the new government

Despite more than two decades of transition from a centrally planned to a market-oriented economy, Myanmar’s economic transition is still only partly complete. The government’s initial strategy for dealing with the swelling deficits of the state economic enterprises (SEEs) was to put them under direct control in order to scrutinize their expenditures. This policy change postponed restructuring and exacerbated the soft budget constraint problem of the SEEs. While the installation of a new government in March 2011 has increased prospects for economic development, sustainable growth still requires full-scale structural reform of the SEEs and institutional infrastructure building. Myanmar can learn from the gradual approaches to economic transition in China and Vietnam, where partial reforms weakened further impetus for reforms.

Negative skill sorting across production chains

Previous literature generally predicts that individuals with higher skills work in industries with longer production chains. However, the opposite skill-sorting pattern, a "negative skill-sorting" phenomenon, is also observed in reality. This paper proposes a possible mechanism by which both cases can happen and shows that negative skill sorting is more likely to occur when the quality of intermediate inputs degrade rapidly (or improves slowly) along the production chain. We empirically confirm our theoretical prediction by using country-industry panel data. The results are robust regardless of estimation method, control variables, and industry coverage. This study has important implications for understanding countries' comparative advantages and development patterns.