Characterization of hLodestar: A CDC5L interacting protein

Lodestar, a Drosophila maternal-effect gene, is essential for proper chromosome segregation during embryonic mitosis. Mutations in lodestar cause chromatin bridging in anaphase, preventing the sister chromatids from fully separating and leaving chromatin tangled at the metaphase plate. Drosophila lodestar protein was originally identified, in purified fractions of Drosophila Kc cell nuclear extracts, by its ability to suppress the generation of long RNA polymerase II transcripts. The human homolog of this protein (hLodestar) was cloned and studied in comparison to the Drosophila lodestar activities. The results of these studies show, similar to the Drosophila protein, hLodestar has dsDNA-dependent ATPase and transcription termination activity in vitro. hLodestar has also been shown to release RNA polymerase I and II stalled at a cyclobutane thymine dimer. Lodestar belongs to the SNF2 family of proteins, which are members of the DExH/D helicase super-family. The SNF2 family of proteins are believed to play a critical role in altering protein-DNA interactions in a variety of cellular contexts. We have recently isolated a human cDNA (hLodestar) that shares significant homology to the Drosophila lodestar gene. The 4.6 kb clone contains an open reading frame of 1162 amino acids, and shares 55% similarity and 46% identity to the Drosophila Lodestar protein sequence. Our studies looking for hLodestar interacting proteins revealed an association with CDC5L in the yeast two-hybrid system and co-immunoprecipitation experiments. CDC5L has been well documented to be a component of the spliceosome. Our data suggests hLodestar is involved in splicing through in vitro assembly and splicing reactions, in addition to its association with spliceosomes purified from HeLa nuclear extract. Although many other members of the DExH/D helicase super-family have been linked to splicing, this is the first SNF2 family member to be implicated in the splicing reaction. ^

Diversity of neuronal connexins in the mammalian retina

Many neurons in the mammalian retina are electrically coupled by intercellular channels or gap junctions, which are assembled from a family of proteins called connexins. Numerous studies indicate that gap junctions differ in properties such as conductance and tracer permeability. For example, A-type horizontal cell gap junctions are permeable to Lucifer Yellow, but B-type horizontal cell gap junctions are not. This suggests the two cell types express different connexins. My hypothesis is that multiple neuronal connexins are expressed in the mammalian retina in a cell type specific manner. Immunohistochemical techniques and confocal microscopy were used to localize certain connexins within well-defined neuronal circuits. The results of this study can be summarized as follows: AII amacrine cells, which receive direct input from rod bipolar cells, are well-coupled to neighboring AIIs. In addition, AII amacrine cells also form gap junctions with ON cone bipolar cells. This is a complex heterocellular network. In both rabbit and primate retina, connexin36 occurs at dendritic crossings in the AII matrix as well as between AIIs and ON cone bipolar cells. Coupling in the AII network is thought to reduce noise in the rod pathway while AII/bipolar gap junctions are required for the transmission of rod signals to ON ganglion cells. In the outer plexiform layer, connexin36 forms gap junctions between cones and between rods and cones via cone telodendria. Cone to cone coupling is thought to reduce noise and is partly color selective. Rod to cone coupling forms an alternative rod pathway thought to operate at intermediate light intensity. A-type horizontal cells in the rabbit retina are strongly coupled via massive low resistance gap junctions composed from Cx50. Coupling dramatically extends the receptive field of horizontal cells and the modulation of coupling is thought to change the strength of the feedback signal from horizontal cells to cones. Finally, there are other coupled networks, such as B-type horizontal cells and S1/S2 amacrine cells, which do not use either connexin36 or Cx50. These results confirm the hypothesis that multiple neuronal connexins are expressed in the mammalian retina and these connexins are localized to particular retinal circuits. ^

Regulation of RNA splicing by nonsense mutations

Translation termination as a result of premature nonsense codon-incorporation in a RNA transcript can lead to the production of aberrant proteins with gain-of-function or dominant negative properties that could have deletrious effects on the cell. T-cell Receptor (TCR) genes acquire premature termination codons two-thirds of the time as a result of the error-prone programmed rearrangement events that normally occur during T-cell development. My studies have focused on the fate of TCR precursor mRNAs in response to in-frame nonsense mutations. ^ Previous published studies from our laboratory have shown that TCR precursor mRNAs are subject to nonsense mediated upregulation of pre-mRNA (NMUP). In this dissertation, I performed substitution and deletion analysis to characterize specific regions of TCR which are required to elicit NMUP. I performed frame- and factor-dependence studies to determine its relationship with other nonsense codon induced responses using several approaches including (i) translation dependence studies (ii) deletion and mutational analysis, as well as (iii) siRNA mediated knockdown of proteins involved. I also addressed the underlying molecular mechanism for this pre-mRNA upregulation by (i) RNA half-life studies using a c-fos inducible promoter, and (ii) a variety of assays to determine pre-mRNA splicing efficiency. ^ Using these approaches, I have identified a region of TCR that is both necessary and sufficient to elicit (NMUP). I have also found that neither cytoplasmic translation machinery nor the protein UPF1 are involved in eliciting this nuclear event. I have shown that the NMUP can be induced not only by nonsense and frameshift mutations, but also missense mutations that disrupt a cis splicing element in the exon that contains the mutation. However, the effect of nonsense mutations on pre-mRNA is unique and distinguishable from that of missense mutations in that nonsense mutations can upregulate pre-mRNA in a frame-dependent manner. Lastly, I provide evidence that NMUP occurs by a mechanism in which nonsense mutations inhibit the splicing of introns. In summary, I have found that TCR precursor mRNAs are subject to multiple forces involving both RNA splicing and translation that can either increase or decrease the levels of these precursor mRNAs. ^

Proteomic identification and functional characterization of prohibitin 1 and 2 in T cell activation, expansion, survival and disease

Several immune pathologies are the result of aberrant regulation of T lymphocytes. Pronounced T cell proliferation can result in autoimmunity or hematologic malignancy, whereas loss of T cell activity can manifest as immunodeficiency. Thus, there is a critical need to characterize the signal transduction pathways that mediate T cell activation so that novel and rational strategies to detect and effectively control T cell mediated disease can be achieved. ^ The first objective of this dissertation was to identify and characterize novel T cell regulatory proteins that are differentially expressed upon antigen induced activation. Using a functional proteomics approach, two members of the prohibitin (Phb) family of proteins, Phb1 and Phb2, were determined to be upregulated upon activation of primary human T cells. Furthermore, their regulated expression was dependent upon CD3 and CD28 signaling pathways which synergistically increased their expression. In contrast to previous reports of Phb nuclear localization, both proteins were determined to localize to the mitochondrial inner membrane of human T cells. Additionally, novel Phb phosphorylation sites were identified and characterized using mass spectrometry, phosphospecific antibodies and site directed mutagenesis. ^ Prohibitins have been proposed to play important roles in cancer development however the mechanism of action has not been elucidated. The second objective of this dissertation was to define the functional role of Phbs in T cell activity, survival and disease. Compared to levels in normal human T cells, Phb expression was higher in the human tumor T cell line Kit225 and subcellularly localized to the mitochondrion. Ablation of Phb expression by siRNA treatment of Kit225 cells resulted in disruption of mitochondrial membrane potential and significantly enhanced their sensitivity to cell death, suggesting they serve a protective function in T cells. Furthermore, Q-RT-PCR analysis of human oncology cDNA expression libraries indicated the Phbs may represent hematological cancer biomarkers. Indeed, Phb1 and Phb2 protein levels were 6-10 fold higher in peripheral blood mononuclear cells isolated from malignant lymphoma and multiple myeloma patients compared to healthy individuals. ^ Taken together, Phb1 and Phb2 are novel phosphoproteins upregulated during T cell activation and transformation to function in the maintenance of mitochondrial integrity and perhaps energy metabolism, thus representing previously unrecognized intracellular biomarkers and therapeutic targets for regulating T cell activation and hematologic malignancies. ^

Role of T cell response during vaccine immunity to tuberculosis

Tuberculosis remains one of the leading causes of death in man due to a single infectious agent. An estimated one-third of the world's population is infected with the causative agent, Mycobacterium tuberculosis (Mtb), despite the availability of the widely used vaccine, BCG. BCG has significantly varying protection rates with the lowest level of protection seen with the most common form of TB, adult pulmonary TB. Thus, numerous studies are being conducted to develop a more efficient vaccine. The ideal candidate vaccine would possess the ability to induce a solid and strong Th1 response, as this is the subset of T cells primarily involved in clearance of the infection. A novel vaccine should also induce such a response that may be recalled and expanded upon subsequent infection. Our group has introduced a mutant of a virulent strain of Mtb which lacks a component of the immunogenic antigen 85 complex (Ag85). Our vaccine, ΔfbpA, does not secrete the fibronectin binding protein Ag85A, and this has shown to lead to its attenuation in both murine macrophages and mice. Previous studies have also proven that ΔfbpA is more protective in mice than BCG against virulent aerosol challenge with Mtb. This study addresses the mechanisms of protection observed with ΔfbpA by phenotyping responding T cells. We first evaluated the ability of dendritic cells to present the mycobacteria to naïve T cells, an in vitro mock of primary immunization. We also measured the response of primed T cells to macrophage-presented mycobacteria to interpret the possible response of a vaccinated host to a boost. We concluded that ΔfbpA can elicit a stronger Th1 response compared to BCG in vitro, and further observed that this enhanced response is at least partly due to the presence of proteins encoded by a region of the genome absent in all strains of BCG. Finally, we observed this heightened Th1 response in the mouse model after primary vaccination and a virulent aerosol challenge. The cytolytic T cell response was also measured after virulent challenge and was found to be superior in the ΔfbpA-treated group when compared to the BCG group. ^

Molecular consequences of the loss of 3'→5' exonuclease activity of DNA polymerases delta and epsilon

The DNA replication polymerases δ and ϵ have an inherent proofreading mechanism in the form of a 3'→5' exonuclease. Upon recognition of errant deoxynucleotide incorporation into DNA, the nascent primer terminus is partitioned to the exonuclease active site where the incorrectly paired nucleotide is excised before resumption of polymerization. The goal of this project was to identify the cellular and molecular consequences of an exonuclease deficiency. The proofreading capability of model system MEFs with EXOII mutations was abolished without altering polymerase function.^ It was hypothesized that 3'→5' exonucleases of polymerases δ and ϵ are critical for prevention of replication stress and important for sensitization to nucleoside analogs. To test this hypothesis, two aims were formulated: Determine the effect of the exonuclease active site mutation on replication related molecular signaling and identify the molecular consequences of an exonuclease deficiency when replication is challenged with nucleoside analogs.^ Via cell cycle studies it was determined that larger populations of exonuclease deficient cells are in the S-phase. There was an increase in levels of replication proteins, cell population growth and DNA synthesis capacity without alteration in cell cycle progression. These findings led to studies of proteins involved in checkpoint activation and DNA damage sensing. Finally, collective modifications at the level of DNA replication likely affect the strand integrity of DNA at the chromosomal level.^ Gemcitabine, a DNA directed nucleoside analog is a substrate of polymerases δ and ϵ and exploits replication to become incorporated into DNA. Though accumulation of gemcitabine triphosphate was similar in all cell types, incorporation into DNA and rates of DNA synthesis were increased in exonuclease defective cells and were not consistent with clonogenic survival. This led to molecular signaling investigations which demonstrated an increase in S-phase cells and activation of a DNA damage response upon gemcitabine treatment.^ Collectively, these data indicate that the loss of exonuclease results in a replication stress response that is likely required to employ other repair mechanisms to remove unexcised mismatches introduced into DNA during replication. When challenged with nucleoside analogs, this ongoing stress response coupled with repair serves as a resistance mechanism to cell death.^

The role of beta-arrestin 2 in lysophosphatidic acid-induced NF-kappaB activation

Lysophosphatidic acid (LPA) is a bioactive phospholipid and binds to its receptors, a family of G protein-coupled receptors (GPCR), which initiates multiple signaling cascades and leads to activation of several transcription factors, including NF-κB. NF-κB critically regulates numerous gene expressions, and is persistently active in many diseases. In our previous studies, we have demonstrated that LPA-induced NF-κB activation is dependent on a novel scaffold protein, CARMA3. However, how CARMA3 is recruited to receptor remains unknown. β-Arrestins are a family of proteins involved in desensitization of GPCR signaling. Additionally, β-arrestins function as signaling adaptor proteins, and mediate multiple signaling pathways. Therefore, we have hypothesized that β-arrestins may link CARMA3 to LPA receptors, and facilitate LPA-induced NF-κB activation. ^ Using β-arrestin-deficient MEFs, we found that β-arrestin 2, but not β-arrestin 1, was required for LPA-induced NF-κB activation. Also, we showed that the expression of NF-κB-dependent cytokines, such as interlukin-6, was impaired in β-arrestin 2-deficient MEFs. Mechanistically, we demonstrated the inducible association of endogenous β-arrestin 2 and CARMA3, and we found the CARD domain of CARMA3 interacted with 60-320 residues of β-arrestin 2. To understand why β-arrestin 2, but not β-arrestin 1, mediated NF-κB activation, we generated β-arrestin mutants. However, some mutants degraded quickly, and the rest did not rescue NF-κB activation in β-arrestin-deficient MEFs, though they had similar binding affinities with CARMA3. Therefore, it indicates that slight changes in residues may determine the different functions of β-arrestins. Moreover, we found β-arrestin 2 deficiency impaired LPA-induced IKK kinase activity, while it did not affect LPA-induced IKKα/β phosphorylation. ^ In summary, our results provide the genetic evidence that β-arrestin 2 serves as a positive regulator in NF-κB signaling pathway by connecting CARMA3 to LPA receptors. Additionally, we demonstrate that β-arrestin 2 is required for IKKα/β activation, but not for the inducible phosphorylation of IKKα/β. Because the signaling pathways around the membrane-proximal region of LPA receptors and GPCRs are quite conserved, our results also suggest a possible link between other GPCRs and CARMA3-mediated NF-κB activation. To fully define the role of β-arrestins in LPA-induced NF-κB signaling pathways will help to identify new drug targets for clinical therapeutics.^

Regulation of Protein Degradation in the Heart by AMP-Activated Protein Kinase

The degradation of proteins by the ubiquitin proteasome system is essential for cellular homeostasis in the heart. An important regulator of metabolic homeostasis is AMP-activated protein kinase (AMPK). During nutrient deprivation, AMPK is activated and intracellular proteolysis is enhanced through the ubiquitin proteasome system (UPS). Whether AMPK plays a role in protein degradation through the UPS in the heart is not known. Here I present data in support of the hypothesis that AMPK transcriptionally regulates key players in the UPS, which, under extreme conditions can be detrimental to the heart. The ubiquitin ligases MAFbx /Atrogin-1 and MuRF1, key regulators of protein degradation, and AMPK activity are increased during nutrient deprivation. Pharmacologic and genetic activation of AMPK is sufficient for the induction of MAFbx/Atrogin-1 and MuRF1 in cardiomyocytes and in the heart in vivo. Comprehensive experiments demonstrate that the molecular mechanism by which AMPK regulates MuRF1 expression is through the transcription factor myocyte enhancer factor 2 (MEF2), which is involved in stress response and cardiomyocyte remodeling. MuRF1 is required for AMPK-mediated protein degradation through the UPS in cardiomyocytes. Consequently, the absence of MuRF1 during chronic fasting preserves cardiac function, possibly by limiting degradation of critical metabolic enzymes. Furthermore, during cardiac hypertrophy, chronic activation of AMPK also leads to cardiac dysfunction, possibly through enhanced protein degradation and metabolic dysregulation. Collectively, my findings demonstrate that AMPK regulates expression of ubiquitin ligases which are required for UPS-mediated protein degradation in the heart. Based on these results, I propose that specific metabolic signals may serve as modulators of intracellular protein degradation in the heart.

Regulation of Protein Degradation in the Heart by AMP-Activated Protein Kinase

The degradation of proteins by the ubiquitin proteasome system is essential for cellular homeostasis in the heart. An important regulator of metabolic homeostasis is AMP-activated protein kinase (AMPK). During nutrient deprivation, AMPK is activated and intracellular proteolysis is enhanced through the ubiquitin proteasome system (UPS). Whether AMPK plays a role in protein degradation through the UPS in the heart is not known. Here I present data in support of the hypothesis that AMPK transcriptionally regulates key players in the UPS, which, under extreme conditions can be detrimental to the heart. The ubiquitin ligases MAFbx /Atrogin-1 and MuRF1, key regulators of protein degradation, and AMPK activity are increased during nutrient deprivation. Pharmacologic and genetic activation of AMPK is sufficient for the induction of MAFbx/Atrogin-1 and MuRF1 in cardiomyocytes and in the heart in vivo. Comprehensive experiments demonstrate that the molecular mechanism by which AMPK regulates MuRF1 expression is through the transcription factor myocyte enhancer factor 2 (MEF2), which is involved in stress response and cardiomyocyte remodeling. MuRF1 is required for AMPK-mediated protein degradation through the UPS in cardiomyocytes. Consequently, the absence of MuRF1 during chronic fasting preserves cardiac function, possibly by limiting degradation of critical metabolic enzymes. Furthermore, during cardiac hypertrophy, chronic activation of AMPK also leads to cardiac dysfunction, possibly through enhanced protein degradation and metabolic dysregulation. Collectively, my findings demonstrate that AMPK regulates expression of ubiquitin ligases which are required for UPS-mediated protein degradation in the heart. Based on these results, I propose that specific metabolic signals may serve as modulators of intracellular protein degradation in the heart.

Cellular Uptake of Neutrohpil Elastase Links Inflammation to Adaptive Immunity

Many tumors arise from sites of inflammation providing evidence that innate immunity is a critical component in the development and progression of cancer. Neutrophils are primary mediators of the innate immune response. Upon activation, an important function of neutrophils is release of an assortment of proteins from their granules including the serine protease neutrophil elastase (NE). The effect of NE on cancer has been attributed primarily to its ability to degrade the extracellular matrix thereby promoting invasion and metastasis. Recently, it was shown that NE could be taken up by lung cancer cells leading to degradation of insulin receptor substrate-1 thereby promoting hyperactivity of the phosphatidylinositol-3 kinase (PI3K) pathway and tumor cell proliferation. To our knowledge, nobody has investigated uptake of NE by other tumor types. In addition, NE has broad substrate specificity suggesting that uptake of NE by tumor cells could impact processes regulating tumorigenensis other than activation of the PI3K pathway. Neutrophil elastase has been identified in breast cancer specimens where high levels of NE have prognostic significance. These studies have assessed NE levels in whole tumor lysates. Because the major source of NE is from activated neutrophils, we hypothesized that breast cancer cells do not have endogenous NE but may take up NE released by tumor associated neutrophils in the tumor microenvironment and that this could provide a link between the innate immune response to tumors and specific adaptive immune responses. In this thesis, we show that breast cancer cells lack endogenous NE expression and that they are able to take up NE resulting in increased generation of low molecular weight cyclin E (CCNE) and enhanced susceptibility to lysis by CCNE-specific cytotoxic T lymphocytes. We also show that after taking up NE and proteinase 3 (PR3), a second primary granule protease with significant homology to NE, breast cancer cells cross-present the NE- and PR3-derived peptide PR1 rendering them susceptible to PR1-targeted therapies. Taken together, our data support a role for NE uptake in modulating adaptive immune responses against breast cancer.

Modeling Techniques for the High-Resolution Interpretation of Cryo-Electron Microscopy Reconstructions

Essential biological processes are governed by organized, dynamic interactions between multiple biomolecular systems. Complexes are thus formed to enable the biological function and get dissembled as the process is completed. Examples of such processes include the translation of the messenger RNA into protein by the ribosome, the folding of proteins by chaperonins or the entry of viruses in host cells. Understanding these fundamental processes by characterizing the molecular mechanisms that enable then, would allow the (better) design of therapies and drugs. Such molecular mechanisms may be revealed trough the structural elucidation of the biomolecular assemblies at the core of these processes. Various experimental techniques may be applied to investigate the molecular architecture of biomolecular assemblies. High-resolution techniques, such as X-ray crystallography, may solve the atomic structure of the system, but are typically constrained to biomolecules of reduced flexibility and dimensions. In particular, X-ray crystallography requires the sample to form a three dimensional (3D) crystal lattice which is technically di‑cult, if not impossible, to obtain, especially for large, dynamic systems. Often these techniques solve the structure of the different constituent components within the assembly, but encounter difficulties when investigating the entire system. On the other hand, imaging techniques, such as cryo-electron microscopy (cryo-EM), are able to depict large systems in near-native environment, without requiring the formation of crystals. The structures solved by cryo-EM cover a wide range of resolutions, from very low level of detail where only the overall shape of the system is visible, to high-resolution that approach, but not yet reach, atomic level of detail. In this dissertation, several modeling methods are introduced to either integrate cryo-EM datasets with structural data from X-ray crystallography, or to directly interpret the cryo-EM reconstruction. Such computational techniques were developed with the goal of creating an atomic model for the cryo-EM data. The low-resolution reconstructions lack the level of detail to permit a direct atomic interpretation, i.e. one cannot reliably locate the atoms or amino-acid residues within the structure obtained by cryo-EM. Thereby one needs to consider additional information, for example, structural data from other sources such as X-ray crystallography, in order to enable such a high-resolution interpretation. Modeling techniques are thus developed to integrate the structural data from the different biophysical sources, examples including the work described in the manuscript I and II of this dissertation. At intermediate and high-resolution, cryo-EM reconstructions depict consistent 3D folds such as tubular features which in general correspond to alpha-helices. Such features can be annotated and later on used to build the atomic model of the system, see manuscript III as alternative. Three manuscripts are presented as part of the PhD dissertation, each introducing a computational technique that facilitates the interpretation of cryo-EM reconstructions. The first manuscript is an application paper that describes a heuristics to generate the atomic model for the protein envelope of the Rift Valley fever virus. The second manuscript introduces the evolutionary tabu search strategies to enable the integration of multiple component atomic structures with the cryo-EM map of their assembly. Finally, the third manuscript develops further the latter technique and apply it to annotate consistent 3D patterns in intermediate-resolution cryo-EM reconstructions. The first manuscript, titled An assembly model for Rift Valley fever virus, was submitted for publication in the Journal of Molecular Biology. The cryo-EM structure of the Rift Valley fever virus was previously solved at 27Å-resolution by Dr. Freiberg and collaborators. Such reconstruction shows the overall shape of the virus envelope, yet the reduced level of detail prevents the direct atomic interpretation. High-resolution structures are not yet available for the entire virus nor for the two different component glycoproteins that form its envelope. However, homology models may be generated for these glycoproteins based on similar structures that are available at atomic resolutions. The manuscript presents the steps required to identify an atomic model of the entire virus envelope, based on the low-resolution cryo-EM map of the envelope and the homology models of the two glycoproteins. Starting with the results of the exhaustive search to place the two glycoproteins, the model is built iterative by running multiple multi-body refinements to hierarchically generate models for the different regions of the envelope. The generated atomic model is supported by prior knowledge regarding virus biology and contains valuable information about the molecular architecture of the system. It provides the basis for further investigations seeking to reveal different processes in which the virus is involved such as assembly or fusion. The second manuscript was recently published in the of Journal of Structural Biology (doi:10.1016/j.jsb.2009.12.028) under the title Evolutionary tabu search strategies for the simultaneous registration of multiple atomic structures in cryo-EM reconstructions. This manuscript introduces the evolutionary tabu search strategies applied to enable a multi-body registration. This technique is a hybrid approach that combines a genetic algorithm with a tabu search strategy to promote the proper exploration of the high-dimensional search space. Similar to the Rift Valley fever virus, it is common that the structure of a large multi-component assembly is available at low-resolution from cryo-EM, while high-resolution structures are solved for the different components but lack for the entire system. Evolutionary tabu search strategies enable the building of an atomic model for the entire system by considering simultaneously the different components. Such registration indirectly introduces spatial constrains as all components need to be placed within the assembly, enabling the proper docked in the low-resolution map of the entire assembly. Along with the method description, the manuscript covers the validation, presenting the benefit of the technique in both synthetic and experimental test cases. Such approach successfully docked multiple components up to resolutions of 40Å. The third manuscript is entitled Evolutionary Bidirectional Expansion for the Annotation of Alpha Helices in Electron Cryo-Microscopy Reconstructions and was submitted for publication in the Journal of Structural Biology. The modeling approach described in this manuscript applies the evolutionary tabu search strategies in combination with the bidirectional expansion to annotate secondary structure elements in intermediate resolution cryo-EM reconstructions. In particular, secondary structure elements such as alpha helices show consistent patterns in cryo-EM data, and are visible as rod-like patterns of high density. The evolutionary tabu search strategy is applied to identify the placement of the different alpha helices, while the bidirectional expansion characterizes their length and curvature. The manuscript presents the validation of the approach at resolutions ranging between 6 and 14Å, a level of detail where alpha helices are visible. Up to resolution of 12 Å, the method measures sensitivities between 70-100% as estimated in experimental test cases, i.e. 70-100% of the alpha-helices were correctly predicted in an automatic manner in the experimental data. The three manuscripts presented in this PhD dissertation cover different computation methods for the integration and interpretation of cryo-EM reconstructions. The methods were developed in the molecular modeling software Sculptor (http://sculptor.biomachina.org) and are available for the scientific community interested in the multi-resolution modeling of cryo-EM data. The work spans a wide range of resolution covering multi-body refinement and registration at low-resolution along with annotation of consistent patterns at high-resolution. Such methods are essential for the modeling of cryo-EM data, and may be applied in other fields where similar spatial problems are encountered, such as medical imaging.

The effects of DNA cytosine methylation on H -ras promoter structure and function

The effect of DNA cytosine methylation on H-ras promoter activity was assessed using a transient expression system employing the plasmid H-rasCAT (NaeI H-ras promoter linked to the chloramphenicol acetyltransferase (CAT) gene). This 551 bp promoter is 80% GC rich, enriched with 168 CpG dinucleotides, and contains six functional GC box elements which represent major DNA methylation target sites. Prokaryotic methyltransferases HhaI (CGm$\sp5$CG) and HpaII (Cm$\sp5$CGG) alone or in combination with a human placental methyltransferase (HP MTase) were used to introduce methyl groups at different CpG sites within the promoter. To test for functional promoter activity, the methylated plasmids were introduced into CV-1 cells and CAT activity assessed 48 h post-transfection. Methylation at specific HhaI and HpaII sites reduced CAT expression by 70%, whereas more extensive methylation at generalized CpG sites with HP MTase inactivated the promoter $>$95%. The inhibition of H-ras promoter activity was not attributable to methylation-induced differences in DNA uptake or stability in the cell, topological form of the plasmid, or methylation effects in nonpromoter regions. We also observed that DNA cytosine methylation of a 360 bp promoter fragment by HP MTase induced a local change in DNA conformation. Using three independent methodologies (nitrocellulose filter binding assays, gel mobility shifts, and Southwestern blots), we determined that this change in promoter conformation affected the interaction of nuclear proteins with cis-regulatory sequences residing in the promoter region. The results provide evidence to suggest that DNA methylation may regulate gene expression by inducing changes in local promoter conformation which in turn alters the interactions between DNA and protein factors required for transcription. The results provide supportive evidence for the hypothesis of Cedar and Riggs, who postulated that DNA methylation may regulate gene expression by altering the binding affinities of proteins for DNA. ^

Cloning and characterization of the full length cDNA and promoter of mouse tissue transglutaminase

Transglutaminases are a family of enzymes that catalyze the covalent cross-linking of proteins through the formation of $\varepsilon$-($\gamma$-glutaminyl)-lysyl isopeptide bonds. Tissue transglutaminase (Tgase) is an intracellular enzyme which is expressed in terminally differentiated and senescent cells and also in cells undergoing apoptotic cell death. To characterize this enzyme and examine its relationship with other members of the transglutaminase family, cDNAs, the first two exons of the gene and 2 kb of the 5$\sp\prime$ flanking region, including the promoter, were isolated. The full length Tgase transcript consists of 66 bp of 5$\sp\prime$-UTR (untranslated) sequence, an open reading frame which encodes 686 amino acids and 1400 bp of 3$\sp\prime$-UTR sequence. Alignment of the deduced Tgase protein sequence with that of other transglutaminases revealed regions of strong homology, particularly in the active site region.^ The Tgase cDNA was used to isolate and characterize a genomic clone encompassing the 5$\sp\prime$ end of the mouse Tgase gene. The transcription start site was defined using genomic and cDNA clones coupled with S1 protection analysis and anchored PCR. This clone includes 2.3 kb upstream of the transcription start site and two exons that contain the first 256 nucleotides of the mouse Tgase cDNA sequence. The exon intron boundaries have been mapped and compared with the exon intron boundaries of three members of the transglutaminase family: human factor XIIIa, the human keratinocyte transglutaminase and human erythrocyte band 4.1. Tissue Tgase exon II is similar to comparable exons of these genes. However, exon I bears no resemblance with any of the other transglutaminase amino terminus exons.^ Previous work in our laboratory has shown that the transcription of the Tgase gene is directly controlled by retinoic acid and retinoic acid receptors. To identify the region of the Tgase gene responsible for regulating its expression, fragments of the Tgase promoter and 5$\sp\prime$-flanking region were cloned into the chloramphenicol actetyl transferase (CAT) reporter constructs. Transient transfection experiments with these constructs demonstrated that the upstream region of Tgase is a functional promoter which contains a retinoid response element within a 1573 nucleotide region spanning nucleotides $-$252 to $-$1825. ^

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

A novel DNA damage inducible inhibitor of p53

p53 is required for the maintenance of the genomic stability of cells. Mutations in the p53 tumor-suppressor gene occur in more than 50% of human cancers of diverse types. In addition, 70% of families with Li-Fraumeni syndrome have a germline mutation in p53, predisposing these individuals to multiple forms of cancer. In response to DNA damage, p53 becomes stabilized and activated. However the exact mechanism by which DNA damage signals the stabilization and activation of p53 still remains elusive. The biochemical activity of p53 that is required for tumor suppression, and presumably the cellular response to DNA damage, involves the ability of the protein to bind to specific DNA sequences and to function as a transcription factor. For the downstream targets, p53 transactivates many genes involved in growth arrest, apoptosis and DNA repair such as p21, Bax and GADD45, respectively. An open question in the field is how cells can determine the downstream effects of p53. ^ We hypothesize that, through its associated proteins, p53 can differentially transactivate its target genes, which determine its downstream effect. Additionally, p53 interacting proteins may be involved in signaling for the stabilization and activation of p53. Therefore, a key aspect to understanding p53 function is the identification and analysis of proteins that interact with it. We have employed the Sos recruitment system (SRS), a cytoplasmic yeast two-hybrid screen to identify p53 interacting proteins. The SRS is based on the ability of Sos to activate Ras when it becomes localized to the plasma membrane. The system takes advantage of an S. cerevisiae strain, cdc25-2 temperature sensitive mutant, harboring a mutation in Sos. In this strain, fusion proteins containing a truncated Sos will only localize to the membrane by protein-protein interaction, which allows growth at non-permissive temperature. This system allows the use of intact transcriptional activators such as p53. ^ To date, using a modified SRS library screen to identify p53 interacting proteins, I have identified p53 (known to interact with itself) and a novel p53-interacting protein (PIP). PIP is a specific p53 interacting protein in the SRS. The interaction of p53 and PIP was further confirmed by performing in vitro and in vivo binding assays. In the in vivo binding study, the interaction can only be detected in the presence of ionizing radiation suggesting that this interaction might be involved in DNA-damage induced p53-signalling pathway. After screening cDNA and genomic libraries, a full-length PIP-cDNA clone ( ∼ 3kb) was obtained which encodes a protein of 429 amino acids with calculated molecular weight of 46 kDa. The results of genebank search indicated that the PIP is an unidentified gene and contains a conserved ring-finger domain, which is present in a diverse family of regulatory proteins involved in different aspects of cellular function. Northern blot analysis revealed that the size of its messenge is approximately 3 kb preferentially expressed in brain, heart, liver and kidney. The PIP protein is mainly located in the cytoplasm as determined by the cellular localization of a green fluorescence fusion protein. Preliminary functional analysis revealed that PIP downregulated the transactivation activity of p53 on both p21 and mdm2 promoters. Thus, PIP may be a novel negative regulator of p53 subsequent to DNA damage. ^