943 resultados para Instrumentation: spectrographs
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Resumo:
The ability of four operational weather forecast models [ECMWF, Action de Recherche Petite Echelle Grande Echelle model (ARPEGE), Regional Atmospheric Climate Model (RACMO), and Met Office] to generate a cloud at the right location and time (the cloud frequency of occurrence) is assessed in the present paper using a two-year time series of observations collected by profiling ground-based active remote sensors (cloud radar and lidar) located at three different sites in western Europe (Cabauw. Netherlands; Chilbolton, United Kingdom; and Palaiseau, France). Particular attention is given to potential biases that may arise from instrumentation differences (especially sensitivity) from one site to another and intermittent sampling. In a second step the statistical properties of the cloud variables involved in most advanced cloud schemes of numerical weather forecast models (ice water content and cloud fraction) are characterized and compared with their counterparts in the models. The two years of observations are first considered as a whole in order to evaluate the accuracy of the statistical representation of the cloud variables in each model. It is shown that all models tend to produce too many high-level clouds, with too-high cloud fraction and ice water content. The midlevel and low-level cloud occurrence is also generally overestimated, with too-low cloud fraction but a correct ice water content. The dataset is then divided into seasons to evaluate the potential of the models to generate different cloud situations in response to different large-scale forcings. Strong variations in cloud occurrence are found in the observations from one season to the same season the following year as well as in the seasonal cycle. Overall, the model biases observed using the whole dataset are still found at seasonal scale, but the models generally manage to well reproduce the observed seasonal variations in cloud occurrence. Overall, models do not generate the same cloud fraction distributions and these distributions do not agree with the observations. Another general conclusion is that the use of continuous ground-based radar and lidar observations is definitely a powerful tool for evaluating model cloud schemes and for a responsive assessment of the benefit achieved by changing or tuning a model cloud
Resumo:
An updated analysis of observed stratospheric temperature variability and trends is presented on the basis of satellite, radiosonde, and lidar observations. Satellite data include measurements from the series of NOAA operational instruments, including the Microwave Sounding Unit covering 1979–2007 and the Stratospheric Sounding Unit (SSU) covering 1979–2005. Radiosonde results are compared for six different data sets, incorporating a variety of homogeneity adjustments to account for changes in instrumentation and observational practices. Temperature changes in the lower stratosphere show cooling of 0.5 K/decade over much of the globe for 1979–2007, with some differences in detail among the different radiosonde and satellite data sets. Substantially larger cooling trends are observed in the Antarctic lower stratosphere during spring and summer, in association with development of the Antarctic ozone hole. Trends in the lower stratosphere derived from radiosonde data are also analyzed for a longer record (back to 1958); trends for the presatellite era (1958–1978) have a large range among the different homogenized data sets, implying large trend uncertainties. Trends in the middle and upper stratosphere have been derived from updated SSU data, taking into account changes in the SSU weighting functions due to observed atmospheric CO2 increases. The results show mean cooling of 0.5–1.5 K/decade during 1979–2005, with the greatest cooling in the upper stratosphere near 40–50 km. Temperature anomalies throughout the stratosphere were relatively constant during the decade 1995–2005. Long records of lidar temperature measurements at a few locations show reasonable agreement with SSU trends, although sampling uncertainties are large in the localized lidar measurements. Updated estimates of the solar cycle influence on stratospheric temperatures show a statistically significant signal in the tropics (30N–S), with an amplitude (solar maximum minus solar minimum) of 0.5 K (lower stratosphere) to 1.0 K (upper stratosphere).
Resumo:
This paper presents a unique two-stage image restoration framework especially for further application of a novel rectangular poor-pixels detector, which, with properties of miniature size, light weight and low power consumption, has great value in the micro vision system. To meet the demand of fast processing, only a few measured images shifted up to subpixel level are needed to join the fusion operation, fewer than those required in traditional approaches. By maximum likelihood estimation with a least squares method, a preliminary restored image is linearly interpolated. After noise removal via Canny operator based level set evolution, the final high-quality restored image is achieved. Experimental results demonstrate effectiveness of the proposed framework. It is a sensible step towards subsequent image understanding and object identification.
Resumo:
A synthesis method is outlined for the design of broadband anti-reflection coatings for use in spaceborne infrared optics. The Golden Section optimisation routine is used to make a search, using designated non-absorptive dielectric thin film combinations, for the coating design which fulfils the required spectral requirements using the least number of layers and different materials. Three examples are given of coatings designed by this method : (I) 1µm to 12µm anti-reflection coating on Zinc Sulphide using Zinc Sulphide and Yttrium Fluoride thin film materials. (ii) 2µm to 14µm anti-reflection coating on Germanium using Germanium and Ytterbium Fluoride thin film materials. (iii) 6µm to 17µm anti-reflection coating on Germanium using Lead Telluride, Zinc Selenide and Barium Fluoride. The measured spectral performance of the manufactured 6µm to 17µm coating on Germanium is given. This is the anti-reflection coating for the germanium optics in the NASA Cassini Orbiter CIRS instrument.
Resumo:
The High Resolution Dynamics Limb Sounder is described, with particular reference to the atmospheric measurements to be made and the rationale behind the measurement strategy. The demands this strategy places on the filters to be used in the instrument and the designs to which this leads to are described. A second set of filters at an intermediate image plane to reduce "Ghost Imaging" is discussed together with their required spectral properties. A method of combining the spectral characteristics of the primary and secondary filters in each channel are combined together with the spectral response of the detectors and other optical elements to obtain the system spectral response weighted appropriately for the Planck function and atmospheric limb absorption. This method is used to demonstrate whether the out-of-band spectral blocking requirement for a channel is being met and an example calculation is demonstrated showing how the blocking is built up for a representative channel. Finally, the techniques used to produce filters of the necessary sub-millimetre sizes together with the testing methods and procedures used to assess the environmental durability and establish space flight quality are discussed.
Resumo:
The North Atlantic Marine Boundary Layer Experiment (NAMBLEX), involving over 50 scientists from 12 institutions, took place at Mace Head, Ireland (53.32° N, 9.90° W), between 23 July and 4 September 2002. A wide range of state-of-the-art instrumentation enabled detailed measurements of the boundary layer structure and atmospheric composition in the gas and aerosol phase to be made, providing one of the most comprehensive in situ studies of the marine boundary layer to date. This overview paper describes the aims of the NAMBLEX project in the context of previous field campaigns in the Marine Boundary Layer (MBL), the overall layout of the site, a summary of the instrumentation deployed, the temporal coverage of the measurement data, and the numerical models used to interpret the field data. Measurements of some trace species were made for the first time during the campaign, which was characterised by predominantly clean air of marine origin, but more polluted air with higher levels of NOx originating from continental regions was also experienced. This paper provides a summary of the meteorological measurements and Planetary Boundary Layer (PBL) structure measurements, presents time series of some of the longer-lived trace species (O3, CO, H2, DMS, CH4, NMHC, NOx, NOy, PAN) and summarises measurements of other species that are described in more detail in other papers within this special issue, namely oxygenated VOCs, HCHO, peroxides, organo-halogenated species, a range of shorter lived halogen species (I2, OIO, IO, BrO), NO3 radicals, photolysis frequencies, the free radicals OH, HO2 and (HO2+Σ RO2), as well as a summary of the aerosol measurements. NAMBLEX was supported by measurements made in the vicinity of Mace Head using the NERC Dornier-228 aircraft. Using ECMWF wind-fields, calculations were made of the air-mass trajectories arriving at Mace Head during NAMBLEX, and were analysed together with both meteorological and trace-gas measurements. In this paper a chemical climatology for the duration of the campaign is presented to interpret the distribution of air-mass origins and emission sources, and to provide a convenient framework of air-mass classification that is used by other papers in this issue for the interpretation of observed variability in levels of trace gases and aerosols.
Resumo:
With continually increasing demands for improvements to atmospheric and planetary remote-sensing instrumentation, for both high optical system performance and extended operational lifetimes, an investigation to access the effects of prolonged exposure of the space environment to a series of infrared interference filters and optical materials was promoted on the NASA LDEF mission. The NASA Long Duration Exposure Facility (LDEF) was launchd by the Space Shuttle to transport various science and technology experiments both to and from space, providing investigators with the opportunity to study the effects of the space environment on materials and systems used in space-flight applications. Preliminary results to be discussed consist of transmission measurements obtained and processed from an infrared spectrophotometer both before (1983) and after (1990) exposure compared with unexposed control specimens, together with results of detailed microscopic and general visual examinations performed on the experiment. The principle lead telluride (PbTe) and Zinc Sulphide (ZnS) based multilayer filters selected for this preliminary investigation consist of : an 8-12µm low pass edge filter, a 10.6µm 2.5% half bandwidth (HBW) double half-wave narrow bandpass filter, and a 10% HBW triple half-wave wide bandpass filter at 15µm. Optical substrates of MgF2 and KRS-5 (T1BrI) will also be discussed.
Resumo:
Electrification of atmospheric dust influences the coagulation, wet removal and fall speeds of dust particles. Alignment of dust particles can also occur in fair weather atmospheric electrical conditions if the particles are charged. However, very few electrical measurements made in elevated dust layers exist. Balloon-borne charge and particle instrumentation have been used to investigate the electrical properties of elevated Saharan dust layers. Soundings from the Cape Verde Islands, which experience frequent Saharan dust outbreaks, intercepted several dust layers. Two balloon soundings during summer 2009 detected dust particles in layers up to 4 km altitude. Simultaneous electrical measurements showed charge inside the dust layers, with a maximum measured charge density of 25 pC m − 3, sufficient to influence wet removal processes.
Resumo:
A deterministic prototype video deghoster is presented which is capable of calculating all the multipath channel distortion characteristics in one single pass and subsequently removing the multipath distortions, commonly termed ghosts. Within the system, a channel identification algorithm finds in isolation all the ghost components while a dedicated DSP filter subsystem is capable of removing ghosts in real time. The results from the system are presented.
Resumo:
Abstract. Not long after Franklin’s iconic studies, an atmospheric electric field was discovered in “fair weather” regions, well away from thunderstorms. The origin of the fair weather field was sought by Lord Kelvin, through development of electrostatic instrumentation and early data logging techniques, but was ultimately explained through the global circuit model of C.T.R. Wilson. In Wilson’s model, charge exchanged by disturbed weather electrifies the ionosphere, and returns via a small vertical current density in fair weather regions. New insights into the relevance of fair weather atmospheric electricity to terrestrial and planetary atmospheres are now emerging. For example, there is a possible role of the global circuit current density in atmospheric processes, such as cloud formation. Beyond natural atmospheric processes, a novel practical application is the use of early atmospheric electrostatic investigations to provide quantitative information on past urban air pollution.